/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 6 Interface residues that do not c... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Interface residues that do not contribute greatly to binding affinity are also generally unimportant for specificity. True/False

Short Answer

Expert verified
True

Step by step solution

01

Understanding the Terms

Interface residues are parts of a molecule, often a protein, that are involved in the binding interaction with another molecule. The "binding affinity" refers to the strength of the interaction, and "specificity" refers to the ability of these molecules to bind precisely to one another among many possible partners.
02

Analyzing the Statement

The statement suggests that if certain interface residues are not crucial for the binding affinity, they are also not significant for the specificity of the interaction. This means that changes in these residues would neither diminish the interaction strength nor alter its selectivity.
03

Connecting Concepts

In many biological interactions, the regions of a molecule that are most crucial for binding affinity also play a significant role in determining specificity, since both rely on precise interactions. If changes in residues substantially affect binding affinity, it's likely they would also impact specificity.
04

Evaluating the Hypothesis

If interface residues do not contribute much to binding affinity, they likely do not play a significant role in the molecular recognition or specificity either. Therefore, the statement suggests a general theme in molecular interactions regarding the link between affinity and specificity.
05

Conclusion

Given the observed connections and dependencies between binding affinity and specificity, the statement is consistent with molecular interaction principles. It reflects that residues unimportant for binding strength often do not impact interaction selectivity either.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Binding Affinity
Binding affinity is a term used to describe how tightly or strongly a protein can bind to another molecule. This interaction is crucial in biological processes. Proteins, which are complex molecules, often interact with other molecules or proteins to perform functions in the body. These interactions need to have the right balance: not too weak, so they can perform their actual function, and not too strong, so they can detach when needed.
For instance, in enzyme reactions, a high binding affinity can mean the substrate stays long enough for the reaction to occur efficiently. However, if it's too high, it might prevent the substrate from leaving, which is also inefficient.
This balance is crucial in drug design, where molecules need to bind effectively to their targets.
  • Factors affecting binding affinity: The shape and size of the binding site.
  • The distribution of charge or hydrophobic regions.
  • Protein flexibility and dynamics.
Understanding binding affinity helps us in designing proteins and drugs that can bind effectively to their targets without causing unintended side effects.
Molecular Specificity
Molecular specificity refers to the ability of proteins to selectively interact with particular molecules out of many possible options. This is essential for the accurate functioning of many biological processes, such as cell signaling and immune responses. Imagine it as a key that fits into a specific lock, where only the right key will turn and perform the function.
The specificity of molecular interactions ensures that cellular processes are not only effective but also precise. This is crucial in immune responses, where antibodies must identify and bind only to specific antigens, excluding others to prevent incorrect immune responses or autoimmune diseases.
  • Determinants of specificity: The three-dimensional structure of a protein, including all folds and curves, dictates which molecules can bind to it.
  • Chemical compatibility, where functional groups must complement each other.
  • Environmental conditions such as pH and temperature can also influence specificity.
Gaining insights into molecular specificity allows for the development of targeted therapies, ensuring treatments are effective and minimize off-target effects.
Interface Residues
Interface residues are specific areas of proteins that come into contact with a partner molecule during binding. These regions are often crucial for the function performed by the protein complex.
Not all interface residues will equally contribute to the strength of the binding (binding affinity) or the selectivity (molecular specificity). Some residues might play a more structural role, ensuring the proper positioning of other critical residues that directly affect binding.
For example, if certain residues at the interface are changed, we might see a decrease in how well a protein can bind to its partner, affecting both its affinity and sometimes, its specificity.
  • Role of Interface Residues: Provide structural support, ensuring other crucial residues are in place for binding.
  • Participate directly in chemical interactions necessary for binding.
  • Facilitate alterations to accommodate different binding partners, thus impacting specificity.
Understanding interface residues is pivotal in protein engineering where modifications can enhance or disrupt binding interactions, which is important in developing drugs or altering protein functions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The affinity of a macromolecular interaction reflects the strength of an interaction for one receptor relative to all other possible receptors. True/False

A tetracycline repressor (TetR) protein, which is present in E. coli at \(10^{-8} \mathrm{M}\) concentration, binds to the teto site with a \(K_{\mathrm{D}}\) of \(10^{-10}\) in the absence of the drug tetracycline and \(a K_{\mathrm{D}}\) of \(10^{-6}\) in the presence of tetracycline. There is one teto site in the E. coli genome, giving a concentration of \(10^{-9} \mathrm{M}\) per cell. There are \(2 \times 10^{5}\) nonmatching sites per cell (a concentration of \(5 \times 10^{-2} \mathrm{M}\) ), to which TetR binds nonspecifically with a \(K_{\mathrm{D}}\) of \(10^{-5}\) a. What is the specificity for the tetO site over the nonmatching sites when no tetracycline is present? b. What is the specificity for the teto site over the nonmatching sites when tetracycline is present? c. How can TetR repressors switch transcription with such low specificity values?

A protein-protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of \(\sim 2000 \AA^{2}\). However, a structure of the interface reveals that only \(1200 \AA^{2}\) of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions?

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

A complex of seven transcription factors binds a DNA enhancer element. The binding is cooperative. What are two molecular mechanisms that the transcription factors might use to achieve this cooperativity?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.