/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 22 A DNA-binding domain binds the s... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Short Answer

Expert verified
a. Each mutation decreases affinity, increasing \(K_D\). b. The double mutant suggests interactions are structurally interdependent.

Step by step solution

01

Understanding Affinity and Mutation Impact

The initial DNA sequence binds to the protein with a dissociation constant \(K_D\) corresponding to a \(25\, \text{nM}\) affinity. Any mutation that results in a \(9\, \text{kcal/mol}\) loss of binding energy affects this affinity.
02

Calculating Effect of Single Mutation

The free energy change \(\Delta G\) of binding is related to the dissociation constant \(K_D\) by the equation:\[ \Delta G = -RT \ln K_D \]A change in \(\Delta G\) by a certain amount will proportionally change \(K_D\). A loss of \(9\, \text{kcal/mol}\) indicates that the mutation causes an increase in \(K_D\), thus reducing binding affinity significantly.
03

Understanding Effect on Double Mutant

For both the protein and DNA to be simultaneously mutated, we expect a cumulative effect on \(\Delta G\). However, if the double mutant results in a similar loss of \(9\, \text{kcal/mol}\), it suggests that the mutations are neither additive nor independently compensatory, pointing towards a potential structural or positional interdependency in the binding site.
04

Analyzing Structural Implications

The result of the double mutant suggests that the binding interactions are likely interdependent, meaning that the presence of either mutation alone sufficiently disrupts the binding site's structural integrity or specific interactions critical for high-affinity binding.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Binding Affinity
Binding affinity refers to the strength of the interaction between a protein and its specific DNA sequence. This is commonly represented by the dissociation constant, expressed as \(K_D\). A low \(K_D\) value indicates high binding affinity, meaning the protein is effectively and strongly binding to the DNA.
  • In the described exercise, the DNA-binding domain initially exhibits a strong binding affinity to the sequence \(\text{GATCGCAATATCGATCGATC}\) with a \(K_D\) of 25 nM. This suggests a highly favorable interaction.
  • The binding strength can be influenced by various factors, including changes or mutations in either the protein or DNA.
When mutations occur, such as a single amino acid alteration in the protein or a nucleotide change in the DNA, the binding affinity can be significantly impacted. These changes are often measured by the change in free energy of binding, \(\Delta G\), which connects directly to \(K_D\). A higher \(K_D\) post-mutation implies reduced affinity, as the connection becomes weaker.
Mutation Impact
Mutations can profoundly affect the protein-DNA interactions by altering the structure or charge at the binding interface. In the exercise example, two mutations resulted in a notable loss of binding free energy by \(9\, \text{kcal/mol}\).
  • The first mutation is a change of Arginine (a positively charged amino acid) to Alanine (a nonpolar amino acid) in the protein, likely disturbing its charge-based interaction with the DNA.
  • The second mutation is a nucleotide change from Thymine to Guanine in the DNA sequence, which might disrupt the hydrogen bonds or stacking interactions within the binding domain.
Both these mutations individually result in decreased binding affinity, evident by the increase in \(K_D\). This showcases how critical specific structural and chemical features are for maintaining high-affinity interactions. The measured energy loss suggests these interactions play a significant role in securing the tight binding of the DNA to the protein.
Free Energy Change
The concept of free energy change, \(\Delta G\), is pivotal in understanding protein-DNA interactions. It provides a quantitative measure of the change in energy when the binding occurs.
  • \(\Delta G\) can be calculated using the formula \( \Delta G = -RT \ln K_D \), where \( R \) is the gas constant and \( T \) is the temperature in Kelvin.
  • In the exercise, a decrease of \(9\, \text{kcal/mol}\) in binding free energy indicates a considerable change in the binding strength.
If two mutations do not lead to a compounded effect, as observed in the double mutant experiment from the exercise, it implies an intrinsic interdependency at the structural or functional level. Such interdependencies may result from spatial proximity within the binding site where the structural alterations caused by one mutation might be compensated by the effects of another, maintaining an overall balance in \(\Delta G\). This can provide a deeper insight into the unique structural dynamics and architecture of the protein-DNA complex.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.