/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 20 A protein-protein interface comp... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A protein-protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of \(\sim 2000 \AA^{2}\). However, a structure of the interface reveals that only \(1200 \AA^{2}\) of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions?

Short Answer

Expert verified
The discrepancy arises from partial burial of residues due to structural factors like incomplete packing.

Step by step solution

01

Understanding the Concept of Buried Surface Area

The buried surface area refers to the part of the protein surface that becomes inaccessible to solvents after protein-protein interaction. The more residues involved in the interface, the greater the expected reduction in surface area.
02

Calculating Expected Buried Surface Area

The expectation is derived from initial calculations based on structures of isolated proteins. If 22 residues are completely buried, the estimated reduction in surface area is around 2000 \( \text{Ã…}^2 \). However, this calculation assumes all residues are fully buried without considering partial exposure.
03

Measuring Actual Buried Surface Area

The structure of the protein-protein interface shows an actual buried surface area of 1200 \( \text{Ã…}^2 \). This value is based on empirical observation and measures the actual extent of burial at the interface.
04

Analyzing the Discrepancy

Not all parts of the residues may be buried, leading to partial exposure and contributing less to surface area reduction. Factors such as flexible side chains, gaps in the interface, or incomplete packing can result in only 1200 \( \text{Ã…}^2 \) being buried.
05

Conclusion and Insights

The discrepancy is likely due to partial burial of residues in the interface. This means that while theoretically two proteins could completely shield 2000 \( \text{Ã…}^2 \) of area, structural factors limit the burial to 1200 \( \text{Ã…}^2 \).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Buried Surface Area
When proteins interact with each other, parts of their surfaces become hidden from view. This hidden area is known as the buried surface area. It is the region that is no longer accessible to solvents such as water. In the context of protein-protein interactions, the buried surface area is significant because it helps determine the strength and specificity of the binding between proteins.
  • A larger buried surface area usually indicates a stronger interaction.
  • The extent of buried surface area also affects the structural stability of the protein complex.
In isolated protein structures, scientists predict the amount of surface area that should be buried upon interaction. This prediction assumes that interacting residues are fully engaged in the interaction without any residues left exposed to solvents.
Protein Structure
Proteins are complex molecules composed of chains of amino acids, which fold into three-dimensional structures. These structures determine the protein's function and interaction with other molecules. The structure of a protein is organized into several levels:
  • Primary Structure: The sequence of amino acids.
  • Secondary Structure: Includes alpha helices and beta sheets formed by hydrogen bonding.
  • Tertiary Structure: The overall 3D shape of a single protein molecule.
  • Quaternary Structure: The arrangement of multiple protein molecules in a multi-subunit complex.
Understanding protein structure is vital because it influences how proteins interact with each other, which in turn affects biochemical pathways and cellular processes within the body.
Molecular Interface
The molecular interface is the region where two protein molecules come into direct contact during an interaction. It consists of specific residues from each protein that engage with one another. The characteristics of a molecular interface include:
  • Residue Complementarity: Residues must complement each other in terms of shape and charge to form a stable interaction.
  • Surface Shape: The interface can vary from very flat to highly contoured or curved.
  • Hydrophobic and Hydrophilic Interactions: These interactions stabilize the protein complex by minimizing repulsion and maximizing attraction.
Studying molecular interfaces provides insight into how proteins function together in the cellular environment and aids in designing drugs that can target protein-protein interactions.
Surface Area Measurement
Surface area measurement in the context of protein interactions involves predicting and measuring the amount of surface area that is buried when two proteins bind. There are methods to measure this:
  • Computational Predictions: These use models to estimate potential buried surface area based on known structures of isolated proteins.
  • Empirical Measurements: Actual experimental data, such as X-ray crystallography, is used to observe how much surface area is truly buried.
Discrepancies between predicted and measured surface areas, like in our exercise, indicate complex and dynamic nature of protein interactions.
  • They may reveal insights about flexibility, partial packing of residues, and gaps in the interface.
  • Understanding these nuances can enhance our comprehension of protein function and interactions at the molecular level.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Which of the following is an attribute of the FGF-FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are \(18 \mathrm{FGF}\) and \(4 \mathrm{FGFR}\) genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds.

A tetracycline repressor (TetR) protein, which is present in E. coli at \(10^{-8} \mathrm{M}\) concentration, binds to the teto site with a \(K_{\mathrm{D}}\) of \(10^{-10}\) in the absence of the drug tetracycline and \(a K_{\mathrm{D}}\) of \(10^{-6}\) in the presence of tetracycline. There is one teto site in the E. coli genome, giving a concentration of \(10^{-9} \mathrm{M}\) per cell. There are \(2 \times 10^{5}\) nonmatching sites per cell (a concentration of \(5 \times 10^{-2} \mathrm{M}\) ), to which TetR binds nonspecifically with a \(K_{\mathrm{D}}\) of \(10^{-5}\) a. What is the specificity for the tetO site over the nonmatching sites when no tetracycline is present? b. What is the specificity for the teto site over the nonmatching sites when tetracycline is present? c. How can TetR repressors switch transcription with such low specificity values?

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Interface residues that do not contribute greatly to binding affinity are also generally unimportant for specificity. True/False

A tryptophan residue near the periphery of a proteinprotein interface is mutated to alanine and changes ti \(K_{\mathrm{D}}\) of binding from \(1 \mathrm{nM}\) to \(40 \mu \mathrm{M}\) at \(300 \mathrm{~K}\). a. How much binding energy was contributed by th: residue? b. Explain whether or not the tryptophan residue is likely a hot spot residue.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.