/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 Which of the following is an att... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Which of the following is an attribute of the FGF-FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are \(18 \mathrm{FGF}\) and \(4 \mathrm{FGFR}\) genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds.

Short Answer

Expert verified
Option c: Selective expression of receptors enhances signaling specificity.

Step by step solution

01

Understanding the Question

We need to identify an attribute of the FGF-FGFR family of interactions from the given options. FGF stands for Fibroblast Growth Factors, and FGFR stands for Fibroblast Growth Factor Receptors, which are important in signaling pathways.
02

Analyzing Option a

Option a states that each FGF ligand has high specificity for an FGF receptor. FGF ligands often interact with multiple FGFRs, indicating less specificity.
03

Analyzing Option b

Option b computes the potential interactions by multiplying the 18 FGF families and the 4 FGFR families, resulting in 72 possible interactions. This is a calculation of potential combinations, not necessarily an observed attribute.
04

Analyzing Option c

Option c mentions enhanced signaling specificity through the selective expression of receptors in different tissues. This suggests that variability in receptor expression allows fine-tuned cellular responses, which is a known attribute of FGF-FGFR signaling.
05

Analyzing Option d

Option d describes FGFRs as soluble serine/threonine kinases. However, FGFRs are actually receptor tyrosine kinases that are membrane-bound, making this statement incorrect.
06

Analyzing Option e

Option e claims that FGF proteins have highly diverse folds. FGF proteins actually share a conserved folding pattern, so this statement does not describe an attribute of the FGF-FGFR family.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Signaling Pathways
Signaling pathways are essential processes that transmit signals from the outside of a cell to its interior, often leading to a specific response. In the context of FGF-FGFR interactions, they play a pivotal role in how cells communicate and respond to their environment. Here’s how it works: once an FGF ligand binds to an FGFR on the cell surface, it triggers a cascade of events inside the cell. This cascade often involves a series of activations of proteins, each set off in turn by the previous one, much like a series of dominoes falling.
These pathways contribute to a wide array of cellular functions, including proliferation, differentiation, and development. One specific example is the mitogen-activated protein kinase (MAPK) pathway, which is often activated by FGF-FGFR binding. This pathway is crucial in cell growth and division.
  • Initiation by ligand-receptor binding
  • Signal transduction across cellular membranes
  • Phosphorylation relays signal internally
By engaging specific signaling pathways, the cell ensures proper functioning and response to various external stimuli. Understanding these pathways supplies insight into how cells maintain homeostasis and adapt to changes in their environment.
Receptor Specificity
Receptor specificity refers to the ability of a receptor, like FGFR, to bind selectively to its ligands, such as the FGF proteins. Despite the possibility of many interactions due to 18 FGF ligands and 4 FGFRs, which might suggest randomness, there is an element of specificity involved.
Each FGFR has a preference for certain FGF ligands, and this specificity is critical for ensuring the appropriate cellular response is activated. This occurs through the structural compatibility between the ligand and the receptor, which ensures only certain interactions take place effectively. Another layer of specificity arises by limiting which receptors are expressed in different tissues. For example, specific FGFRs may only be expressed in particular tissue types, allowing the fine-tuning of cellular responses in different body parts.
  • Structural compatibility between ligands and receptors
  • Selective receptor expression in tissues
  • Fine-tuning of signaling pathways
This multifaceted approach to receptor specificity ensures that cells can precisely control their responses and interactions, maintaining efficient biological processes.
Cellular Responses
Cellular responses are the results of the complex interplay between FGF proteins and FGFRs through their signaling pathways. Once activated by an FGF ligand, an FGFR triggers downstream signaling pathways, leading to specific responses at the cellular level. These responses are tightly regulated and tailored to the needs of the organism at any given time.
Different tissues will have varying responses depending on the type and quantity of FGFRs expressed. For instance, in some contexts, FGF-FGFR interactions may lead to increased cell proliferation, helping in tissue regeneration. In other scenarios, they may promote differentiation, guiding cells to adopt specific functions, which is crucial in developmental processes.
  • Activation of downstream signaling pathways
  • Tissue-specific responses
  • Functions such as proliferation and differentiation
These targeted cellular responses are vital for ensuring that signals from the external environment can result in appropriate actions within the organism, maintaining balance and facilitating growth, repair, and adaptive changes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A tryptophan residue near the periphery of a proteinprotein interface is mutated to alanine and changes ti \(K_{\mathrm{D}}\) of binding from \(1 \mathrm{nM}\) to \(40 \mu \mathrm{M}\) at \(300 \mathrm{~K}\). a. How much binding energy was contributed by th: residue? b. Explain whether or not the tryptophan residue is likely a hot spot residue.

Interface residues that do not contribute greatly to binding affinity are also generally unimportant for specificity. True/False

The affinity of a macromolecular interaction reflects the strength of an interaction for one receptor relative to all other possible receptors. True/False

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

A protein-protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of \(\sim 2000 \AA^{2}\). However, a structure of the interface reveals that only \(1200 \AA^{2}\) of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.