/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 1 The affinity of a macromolecular... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The affinity of a macromolecular interaction reflects the strength of an interaction for one receptor relative to all other possible receptors. True/False

Short Answer

Expert verified
False

Step by step solution

01

Understanding the Statement

The problem presents a statement regarding the affinity of a macromolecular interaction and asks if it is true or false. Affinity measures how strongly a macromolecule, like an enzyme or receptor, binds to a ligand or substrate. The key point here is whether 'affinity' reflects the strength of interaction specifically towards all other possible receptors rather than just the given one.
02

Analyzing 'Affinity'

In biochemistry, affinity is typically used to describe the strength of binding between a single receptor and a ligand. It does not directly compare this binding to all other possible receptors. Instead, affinity is a measure of how strongly a ligand binds to its specific receptor, not relative to other receptors.
03

Conclusion Based on Analysis

Since the definition of affinity involves the interaction strength between a ligand and a single specific receptor, rather than relative to all possible receptors, the statement does not accurately represent the concept of affinity. Thus, the statement is false.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Affinity in Biochemistry
Biochemistry often discusses affinity as a critical component of how molecules, particularly proteins, interact with each other.
Think of affinity as the 'stickiness' between two molecules, like a lock and key fitting perfectly together.
  • In this context, the "lock" might be a receptor on a cell's surface, and the "key" could be a signaling molecule or drug that fits into it.
  • Affinity specifically refers to the strength of the binding interaction between these components.
  • In a typical biochemistry setup, this means the interaction between one particular ligand and its designated receptor.
It's important to note that affinity does not measure how a ligand binds to different types of receptors but rather how well it binds to one specific receptor.
This is quantified often through the affinity constant or dissociation constant. The lower the dissociation constant, the higher the affinity, indicating a stronger, more durable interaction.
Overall, understanding the affinity helps scientists design drugs that optimize the desirable 'stickiness' for better efficacy.
Ligand-Receptor Binding
Ligand-receptor binding is a biological interaction poised at the heart of signaling processes in cells.
A ligand is a molecule that binds to a receptor, triggering a specific response inside the cell.
  • This interaction resembles a docking event, where the ligand binds to a particular site on the receptor called the binding site.
  • Each receptor has a unique binding site which is complementary in shape to its specific ligand.
  • This specificity ensures that only particular ligands can activate certain receptors, much like only a specific key can open a specific lock.
Receptor-ligand interactions are not static; they can be influenced by various environmental factors such as temperature, pH, and the presence of other molecules.
In biochemical terms, ligands could be hormones, neurotransmitters, or even synthetic drugs designed to mimic or inhibit natural ligands.
This precise binding is pivotal for translating extracellular signals into intracellular actions, leading to changes in cell behavior, function, or fate.
Enzyme-Substrate Interactions
Enzyme-substrate interactions are essential for facilitating biochemical reactions in living organisms.
Enzymes are protein catalysts that speed up biochemical reactions necessary for life.
  • The substrate is the reactant that an enzyme acts upon during a reaction.
  • Enzymes possess active sites, specialized regions where substrates bind.
  • This binding reduces the activation energy required for a reaction, allowing it to proceed more readily.
The interaction between an enzyme and its substrate is extremely specific and can be compared to a dedicated docking station.
The specificity is driven by the precise 3D structure; enzymes only bind substrates that fit perfectly into the active site.
Upon binding, enzymes undergo conformational changes to better accommodate the substrate, a phenomenon known as induced fit.
Understanding enzyme-substrate interactions is crucial for developing inhibitors that can prevent undesired reactions, such as those occurring in disease pathways.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A tetracycline repressor (TetR) protein, which is present in E. coli at \(10^{-8} \mathrm{M}\) concentration, binds to the teto site with a \(K_{\mathrm{D}}\) of \(10^{-10}\) in the absence of the drug tetracycline and \(a K_{\mathrm{D}}\) of \(10^{-6}\) in the presence of tetracycline. There is one teto site in the E. coli genome, giving a concentration of \(10^{-9} \mathrm{M}\) per cell. There are \(2 \times 10^{5}\) nonmatching sites per cell (a concentration of \(5 \times 10^{-2} \mathrm{M}\) ), to which TetR binds nonspecifically with a \(K_{\mathrm{D}}\) of \(10^{-5}\) a. What is the specificity for the tetO site over the nonmatching sites when no tetracycline is present? b. What is the specificity for the teto site over the nonmatching sites when tetracycline is present? c. How can TetR repressors switch transcription with such low specificity values?

Which of the following is an attribute of the FGF-FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are \(18 \mathrm{FGF}\) and \(4 \mathrm{FGFR}\) genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds.

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Specificity depends on the concentration of ligand, whereas affinity is independent of ligand concentration. True/False

A tryptophan residue near the periphery of a proteinprotein interface is mutated to alanine and changes ti \(K_{\mathrm{D}}\) of binding from \(1 \mathrm{nM}\) to \(40 \mu \mathrm{M}\) at \(300 \mathrm{~K}\). a. How much binding energy was contributed by th: residue? b. Explain whether or not the tryptophan residue is likely a hot spot residue.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.