/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 A tetracycline repressor (TetR) ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A tetracycline repressor (TetR) protein, which is present in E. coli at \(10^{-8} \mathrm{M}\) concentration, binds to the teto site with a \(K_{\mathrm{D}}\) of \(10^{-10}\) in the absence of the drug tetracycline and \(a K_{\mathrm{D}}\) of \(10^{-6}\) in the presence of tetracycline. There is one teto site in the E. coli genome, giving a concentration of \(10^{-9} \mathrm{M}\) per cell. There are \(2 \times 10^{5}\) nonmatching sites per cell (a concentration of \(5 \times 10^{-2} \mathrm{M}\) ), to which TetR binds nonspecifically with a \(K_{\mathrm{D}}\) of \(10^{-5}\) a. What is the specificity for the tetO site over the nonmatching sites when no tetracycline is present? b. What is the specificity for the teto site over the nonmatching sites when tetracycline is present? c. How can TetR repressors switch transcription with such low specificity values?

Short Answer

Expert verified
a. Specificity is \(10^5\); b. Specificity is \(10\); c. TetR switches transcription by altering active repressor concentration and binding cooperativity.

Step by step solution

01

Understand the Problem

We need to compare the specificity of a TetR protein for binding to its target, the tetO site, versus non-target nonmatching sites under two conditions: absence and presence of tetracycline. Specificity can be evaluated by comparing the binding equilibrium constants (\( K_D \)) for these interactions.
02

Specificity Calculation without Tetracycline

When no tetracycline is present, TetR binds to the tetO site with \( K_{D, ext{tetO}} = 10^{-10} \, \text{M} \) and to nonmatching sites with \( K_{D, ext{nonmatch}} = 10^{-5} \, \text{M} \). The specificity for tetO over nonmatching is given by the ratio \( \frac{K_{D, ext{nonmatch}}}{K_{D, ext{tetO}}} \). Calculate this as \( \frac{10^{-5}}{10^{-10}} = 10^5 \).
03

Specificity Calculation with Tetracycline

In the presence of tetracycline, TetR binds to tetO with \( K_{D, ext{tetO,drug}} = 10^{-6} \, \text{M} \) and to nonmatching sites with the same \( K_{D, ext{nonmatch}} = 10^{-5} \, \text{M} \). The specificity is \( \frac{K_{D, ext{nonmatch}}}{K_{D, ext{tetO,drug}}} = \frac{10^{-5}}{10^{-6}} = 10 \).
04

Understanding Switching with Low Specificity

Even with low specificity, TetR can regulate transcription due to the dynamic concentration of active repressors and cooperativity in binding. The drastic change in \( K_D \) values allows for significant differential binding between tetO and nonmatching sites with or without tetracycline, enabling transcriptional switch mechanisms.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Protein-DNA Interaction
Protein-DNA interaction is fundamental in molecular biology as it drives crucial biological processes such as transcription, replication, and repair. Proteins like the tetracycline repressor (TetR) can bind specifically to DNA sequences called operons. The TetR protein binds specifically to the tetO site in the E. coli genome. This specific binding is critical for regulating the expression of genes.

The interaction between a protein and DNA depends on the affinity, which is the protein's ability to bind to a specific DNA sequence over others. This specificity allows the protein to only regulate the genes it needs to, without affecting others. In this context, TetR not only binds to the tetO site, but it also interacts, albeit less strongly, with nonmatching sites in the DNA. These interactions illustrate the balance between specificity and nonspecific binding, which is influenced by the concentration of the repressor and environmental factors like the presence of drugs such as tetracycline.

Proteins can recognize their specific DNA binding sites through various forces, including hydrogen bonds, van der Waals forces, and ionic interactions, ensuring strong and selective binding. This ability to distinguish target sequences from non-target sequences is fundamental for the control of gene expression.
Equilibrium Constant (K_D)
The equilibrium constant (K_D) is a pivotal concept in understanding protein-DNA interactions. It measures the affinity between a protein and a DNA molecule. Essentially, K_D is the ratio of the rate at which a protein binds to a DNA sequence and the rate at which it dissociates. A low K_D value indicates high affinity, meaning the protein binds tightly to the DNA, while a high K_D value suggests low affinity.

For the TetR-tetO interaction, the K_D value without tetracycline is 10^{-10} M, denoting a strong binding to the DNA. With tetracycline, this value rises to 10^{-6} M, showing reduced affinity. This change is critical for gene regulation because it reflects how the presence of tetracycline influences binding and, consequently, protein function.

Calculating specificity involves comparing these K_D values. For instance, without tetracycline, the specificity for the tetO site over nonmatching sites (which have a K_D of 10^{-5} M) can be expressed as a ratio: \( rac{K_{D,\text{nonmatch}}}{K_{D,\text{tetO}}} = 10^5\). This ratio illustrates the preferential binding of TetR to its correct site, a crucial factor for effective gene regulation.
Gene Regulation
Gene regulation is the process by which cells control the expression and activity of genes. It ensures that the right genes are expressed at the right times, allowing cells to respond to their environment and perform necessary functions. A protein like TetR plays a critical role in this process through its ability to act as a repressor.

In the case of TetR, this protein regulates the transcription of genes by binding to the tetO site. When TetR binds tightly (in the absence of tetracycline), it prevents the transcription machinery from accessing the DNA, effectively silencing the gene. When tetracycline is present, the reduced affinity (higher K_D) for the tetO site allows the transcription machinery to access the DNA and express the gene, switching the gene regulation on.

Even with low specificity in some conditions, proteins like TetR can finely tune gene expression. This is possible due to factors like cooperativity, where the binding of one protein affects the binding of others, and changes in environmental conditions that influence protein activity. This dynamic regulation is essential for cellular adaptation and the precise control over genetic expression.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Which of the following statements regarding interfacial waters is true? a. They contribute favorably to the entropy of protein-protein recognition. b. They help to optimize the packing at the contact surface. c. They contribute only to affinity, but not to the specificity of protein- protein recognition. d. There are typically fewer water-mediated hydrogen bonds than direct hydrogen bonds at protein-protein interfaces.

A protein-protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of \(\sim 2000 \AA^{2}\). However, a structure of the interface reveals that only \(1200 \AA^{2}\) of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions?

A tryptophan residue near the periphery of a proteinprotein interface is mutated to alanine and changes ti \(K_{\mathrm{D}}\) of binding from \(1 \mathrm{nM}\) to \(40 \mu \mathrm{M}\) at \(300 \mathrm{~K}\). a. How much binding energy was contributed by th: residue? b. Explain whether or not the tryptophan residue is likely a hot spot residue.

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Which of the following is an attribute of the FGF-FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are \(18 \mathrm{FGF}\) and \(4 \mathrm{FGFR}\) genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.