/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 24 A complex of seven transcription... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A complex of seven transcription factors binds a DNA enhancer element. The binding is cooperative. What are two molecular mechanisms that the transcription factors might use to achieve this cooperativity?

Short Answer

Expert verified
Allosteric changes and recruitment of coactivators.

Step by step solution

01

Understanding Transcription Factors and Cooperativity

Transcription factors are proteins that help regulate the transcription of genes by binding to specific DNA sequences. Cooperativity refers to the idea that the binding of one transcription factor can increase the likelihood of additional transcription factors binding at nearby sites.
02

Mechanism 1 - Allosteric Changes

One molecular mechanism for cooperativity is allosteric regulation. When one transcription factor binds to the DNA enhancer element, it can induce a conformational change in the DNA or in the transcription factor itself. This change might make it easier for additional transcription factors to bind, thereby enhancing their cooperative interaction.
03

Mechanism 2 - Recruitment of Coactivators

The second mechanism involves the recruitment of coactivators or other regulatory proteins. When a transcription factor binds, it might recruit coactivators that modify the chromatin structure, making the DNA more accessible for other transcription factors to bind. This process increases the binding efficiency and cooperativity among the transcription factors.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Cooperativity
Cooperativity in transcription factor binding is a fascinating phenomenon. It plays a critical role in gene regulation by influencing how transcription factors interact with DNA. When we say that transcription factors bind "cooperatively," we mean that the presence of one transcription factor increases the likelihood of others binding nearby. This interaction isn't random. It's a well-orchestrated process that can amplify or diminish the transcriptional response of a gene. Imagine it like a group of friends trying to lift a heavy object. One friend alone might struggle. But as more friends rally around, they can lift it with ease. The binding of transcription factors works similarly. One factor binding makes it easier for others to attach and hold on. This cooperative binding can create a sharp switch in gene expression. This switch can ensure that only the right genes are turned on at the right times. It also allows cells to respond sensitively to different signals in the environment. By increasing the likelihood of subsequent binding events, cooperativity ensures that the transcription process is robust and reliable.
Allosteric Regulation
Allosteric regulation is one of the key molecular mechanisms that transcription factors use to achieve cooperativity. An intriguing aspect of biological systems is how molecules communicate. In the case of transcription factors, allosteric changes play a crucial part in this communication. When a transcription factor binds to a DNA enhancer, it can trigger a structural change. This change might occur in the DNA itself or within the transcription factor protein, altering its shape or conformation. Such a structural change can significantly impact the binding dynamics. Here's how it helps: this allosteric modification makes it easier for additional transcription factors to bind to nearby DNA. Like a key turning more smoothly in a lock, the initial transcription factor binding "unlocks" the potential for others to join the party. This leads to more efficient gene transcription as more factors gather at once. This mechanism not only facilitates the cooperative binding of transcription factors but also ensures that these proteins can quickly and effectively respond to cellular signals. It's a brilliant way the cell fine-tunes gene expression!
Coactivators
Coactivators are indispensable players in the transcription factor binding process. They help transcription factors increase cooperativity in a seamless manner. But what exactly do they do? When a transcription factor first attaches to a DNA site, it often recruits coactivators. These are proteins or other molecules that do not bind to DNA directly but assist in the transcription process. Think of them as helpful assistants in a complex task. One of the major roles of coactivators is to modify chromatin structure. Chromatin is a "packaging" form of DNA. It can be tightly wound, making it difficult for transcription factors to access. Coactivators help by loosening this packaging, effectively "unwrapping" sections of DNA and making it easier for other transcription factors to bind. This "unwrapping" process is crucial as it increases the binding efficiency and augment the cooperative efforts of transcription factors. In essence, coactivators set the stage for an efficient transcription process by facilitating the easier binding of these factors to DNA. They ensure the overall cooperation needed for effective gene expression.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a \(25 \mathrm{nM}\) affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined "T" to " \(\mathrm{G}\) " in the DNA sequence both result in a \(9 \mathrm{k} \cdot \mathrm{mol}^{-1}\) loss of binding free energy. Simultaneous mutation of both the protein and the DNA a. What is the effect on the \(K_{\mathrm{D}}\) of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein-DNA interaction?

Specificity depends on the concentration of ligand, whereas affinity is independent of ligand concentration. True/False

The affinity of a macromolecular interaction reflects the strength of an interaction for one receptor relative to all other possible receptors. True/False

Which of the following statements regarding interfacial waters is true? a. They contribute favorably to the entropy of protein-protein recognition. b. They help to optimize the packing at the contact surface. c. They contribute only to affinity, but not to the specificity of protein- protein recognition. d. There are typically fewer water-mediated hydrogen bonds than direct hydrogen bonds at protein-protein interfaces.

A tetracycline repressor (TetR) protein, which is present in E. coli at \(10^{-8} \mathrm{M}\) concentration, binds to the teto site with a \(K_{\mathrm{D}}\) of \(10^{-10}\) in the absence of the drug tetracycline and \(a K_{\mathrm{D}}\) of \(10^{-6}\) in the presence of tetracycline. There is one teto site in the E. coli genome, giving a concentration of \(10^{-9} \mathrm{M}\) per cell. There are \(2 \times 10^{5}\) nonmatching sites per cell (a concentration of \(5 \times 10^{-2} \mathrm{M}\) ), to which TetR binds nonspecifically with a \(K_{\mathrm{D}}\) of \(10^{-5}\) a. What is the specificity for the tetO site over the nonmatching sites when no tetracycline is present? b. What is the specificity for the teto site over the nonmatching sites when tetracycline is present? c. How can TetR repressors switch transcription with such low specificity values?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.