/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 5 Describe how the rate of transcr... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 21: Problem 5

Describe how the rate of transcription of the lac operon is affected when \(E\). coli cells are grown in the presence of (a) lactose plus glucose, (b) glucose alone, and (c) lactose alone.

Short Answer

Expert verified
The rate of transcription of the lac operon when E.coli cells are grown (a) in the presence of lactose and glucose is low due to the preferential use of glucose, (b) in the presence of glucose alone is minimum or none as the repressor remains bound and the presence of glucose suppresses the operon, and (c) in the presence of lactose alone is high as lactose will inactivate the repressor and there's no glucose to suppress the operon.

Step by step solution

01

Understand the influence of lactose and glucose on lac operon

E. coli's lac operon is a series of genes that are transcribed together to deal with the presence of lactose but its action can be inhibited by glucose. This series of genes is regulated by a promoter (where RNA polymerase binds and starts transcription), an operator (where the repressor protein binds to block transcription), and a repressor gene.
02

Transcription in presence of lactose and glucose

When E. coli is grown in the presence of both lactose and glucose, glucose inhibits the activation of the lac operon even though lactose is present. This is because the bacteria prefer glucose over lactose for their nutritional needs. So, the amount of transcription on the lac operon is low.
03

Transcription in presence of glucose alone

When E. coli is grown in the presence of glucose alone, no lactose means the repressor remains bound to the operator, preventing transcription. Also, the presence of glucose would have suppressed the operon anyway. So the amount of transcription is minimum or none.
04

Transcription in presence of lactose alone

When E. coli is grown in the presence of lactose alone, lactose will bind to the repressor protein, which prevents the repressor from binding to the operator. And without glucose, there's no suppression of the operon. Therefore, transcription of the lac operon will be high.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In general, if we know the genomic DNA sequence of a gene we can reliably predict the nucleotide sequence of the RNA encoded by that gene. Is this statement also true for tRNAs in prokaryotes? What about tRNAs in eukaryotes?

Why are mutations within an intron of a protein-coding gene sometimes detrimental?

When \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP is incubated with a eukaryotic cell extract that is capable of transcription and RNA processing, where does the label appear in mRNA?

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

Unlike DNA polymerase, RNA polymerase does not have proofreading activity. Explain why the lack of proofreading activity is not detrimental to the cell.
See all solutions

Recommended explanations on Chemistry Textbooks

Kinetics

Read Explanation

Inorganic Chemistry

Read Explanation

Ionic and Molecular Compounds

Read Explanation

Physical Chemistry

Read Explanation

Chemical Reactions

Read Explanation

Making Measurements

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.