/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 7 When \(\beta-\left[{ }^{32} \mat... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 21: Problem 7

When \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP is incubated with a eukaryotic cell extract that is capable of transcription and RNA processing, where does the label appear in mRNA?

Short Answer

Expert verified
The label from \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP appears in the phosphate-sugar backbone of the synthesized mRNA during transcription.

Step by step solution

01

Understanding the Basic Process of Transcription

In the biological process of transcription, specific segments of DNA are converted into RNA by the enzyme RNA polymerase. mRNA is a type of RNA, which is then translated to form proteins. During transcription, ribonucleoside triphosphates, including ATP, serve as the nucleotide precursors from which RNA polymerases synthesize the new RNA strand.
02

Role of ATP in Transcription

Phosphorus is a fundamental component of ATP. In the transcription process, ATP provides the phosphate group that links the ribonucleosides together to form the RNA strand. This is done by breaking the high-energy phosphate bond in ATP, resulting in the addition of a nucleoside monophosphate to the growing RNA chain and the release of inorganic pyrophosphate.
03

Use of Radioactive ATP

The radioactive \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP is used as a tracer in biological experiments to track the position of ATP in a reaction. When a cell extract capable of transcription and RNA processing is incubated with radioactive ATP, the ATP is incorporated into the newly synthesized mRNA during transcription. Thus, by using radioactive ATP, it is possible to track the path of ATP in the transcription process.
04

Location of the \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP Label in mRNA

Because ATP is used to form the phosphate-sugar backbone of the RNA strand during transcription, the radioactive label from \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP would be found in the backbone of the synthesized mRNA molecule.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Synthesis
Transcription is the first step in the fascinating journey from DNA to protein. In eukaryotic cells, this process begins in the nucleus, where the double-stranded DNA serves as a template. The enzyme responsible, RNA polymerase, reads this DNA template strand and constructs a complementary RNA strand.
Specifically, it synthesizes messenger RNA (mRNA), a molecule that will later be used for protein production. During transcription, ribonucleoside triphosphates (rNTPs) such as ATP, GTP, CTP, and UTP supply the building blocks for the RNA chain.
The polymerase orchestrates the addition of these nucleotides, ensuring that the RNA sequence faithfully mirrors the DNA code.
ATP Incorporation
Adenosine triphosphate (ATP) plays a critical role during transcription, not only as an energy currency but also as a building block for RNA. During the elongation phase, RNA polymerase takes ATP and incorporates it into the growing RNA strand.
Each ATP molecule provides an adenosine base and the vital phosphate groups.
  • The phosphate groups form part of the RNA's sugar-phosphate backbone.
  • The incorporation of ATP involves breaking a high-energy phosphate bond, a process that releases energy.
  • This energy helps drive the synthesis of the RNA chain.
Understanding ATP's dual role is crucial for appreciating how energy and structure interweave in biological processes.
Radioactive Labeling
Radioactive labeling is a powerful technique used to track molecules in biological systems. Scientists use \( \beta-\left[ {}^{32} \mathrm{P} \right]\)-ATP to label nucleotides, allowing researchers to follow their incorporation into molecules like RNA. When \( \beta-\left[ {}^{32} \mathrm{P} \right]\)-ATP is used in transcription assays:
  • The radioactive label is attached to the ATP.
  • As ATP is incorporated into the mRNA, the label provides a visible marker.
  • The location of the radioactive \( {}^{32} \mathrm{P} \)-ATP can be detected using autoradiography or other methods.
This enables scientists to map where ATP molecules are used in the synthesis process, revealing intricate details of transcription mechanics.
mRNA Processing
After transcription, mRNA undergoes several modifications before it is ready for translation. In eukaryotic cells, these processing steps enhance stability and ensure accurate translation. The main steps in mRNA processing include:
  • **Capping:** A 5' cap is added to the beginning of the mRNA molecule, protecting it from degradation.
  • **Polyadenylation:** A poly-A tail is added to the 3' end, further protecting the mRNA and aiding in its export from the nucleus.
  • **Splicing:** Introns, or non-coding regions, are removed, and exons, the coding sequences, are spliced together. This involves complex molecular machinery known as the spliceosome.
Together, these modifications prepare the mRNA to be a stable template for protein production, ensuring the correct polypeptide is produced during translation.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

A deletion in one of the introns in the gene for the triose phosphate isomerase moves the branch site to a new location 7 nucleotides away from the \(3^{\prime}\)-splice acceptor sequence. Will this deletion have any affect on splicing of the gene?

The E. coli genome is approximately \(4600 \mathrm{~kb}\) in size and contains about 4000 genes. The mammalian genome is approximately \(3 \times 10^{6} \mathrm{~kb}\) in size and contains at most 50000 genes. An average gene in \(E\). coli is 1000 bp long. (a) Calculate the percentage of \(E\). coli DNA that is not transcribed. (b) Although many mammalian genes are larger than bacterial genes, most mammalian gene products are the same size as bacterial gene products. Calculate the percentage of DNA in exons in the mammalian genome

Mature mRNA from eukaryotic cells is often purified from other components in the cell with the use of columns containing oligo (dT) cellulose. These columns contain short segments of single-stranded deoxyribose thymidylate residues, oligo(dT), attached to a cellulose matrix. Explain the rationale for use of these columns to purify mature mRNA from a mixture of components.

Assume that, in a rare instance, a typical eukaryotic triose phosphate isomerase gene contains the correct sequences to permit accurate transcription in a prokaryotic cell. Would the resulting RNA be properly translated to yield the intact enzyme?
See all solutions

Recommended explanations on Chemistry Textbooks

The Earths Atmosphere

Read Explanation

Chemical Analysis

Read Explanation

Chemical Reactions

Read Explanation

Chemistry Branches

Read Explanation

Inorganic Chemistry

Read Explanation

Kinetics

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.