/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Principles of Biochemistry Chapter 19 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 1

Compare hydrogen bonding in the \(\alpha\) helix of proteins to hydrogen bonding in the double helix of DNA. Include in the answer the role of hydrogen bonding in stabilizing these two structures.

Problem 2

A stretch of double-stranded DNA contains \(1000 \mathrm{bp}\), and its base composition is \(58 \%(\mathrm{G}+\mathrm{C})\). How many thymine residues are in this region of DNA?

Problem 3

(a) Do the two complementary strands of a segment of DNA have the same base composition? (b) Does \((\mathrm{A}+\mathrm{G})\) equal \((\mathrm{C}+\mathrm{T})\) ?

Problem 4

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.

Problem 5

Poly A forms a single-stranded helix. What forces stabilize this structure?

Problem 9

Consider a processive exonuclease that binds exclusively to double-stranded DNA and degrades one strand in the \(5^{\prime} \rightarrow 3^{\prime}\) direction. In a reaction where the substrate is a 1 kb fragment of linear DNA, what will be the predominant products after the digestion has gone to completion?

Problem 12

A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by the following enzymes: (a) a \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage (b) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(5^{\prime}\) ester bond of a phosphodiester linkage (c) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage

Problem 13

A non-sequence-specific endonuclease purified from \(A s\) pergillus oryzae digests single-stranded DNA. Predict the effect of adding this enzyme to a preparation of negatively supercoiled plasmid DNA.

Problem 14

One of the proteins in rattlesnake venom is an enzyme named phosphodiesterase. Could polynucleotides be a substrate for this enzyme? Why or why not?

Problem 15

RNase T1 cleaves RNA after \(\mathrm{G}\) residues to leave a \(3^{\prime}\) phosphate group. Predict the cleavage products of this substrate: $$ \text { pppApCpUpCpApUpApGpCpUpApUpGpApGpU } $$

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks