/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Principles of Biochemistry Chapter 21 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 1

A bacterial RNA polymerase elongates RNA at a rate of 70 nucleotides per second, and each transcription complex covers 70 bp of DNA. (a) What is the maximum number of RNA molecules that can be produced per minute from a gene of \(6000 \mathrm{bp}\) ? (Assume that initiation is not rate-limiting.) (b) What is the maximum number of transcription complexes that can be bound to this gene at one time?

Problem 2

The E. coli genome is approximately \(4600 \mathrm{~kb}\) in size and contains about 4000 genes. The mammalian genome is approximately \(3 \times 10^{6} \mathrm{~kb}\) in size and contains at most 50000 genes. An average gene in \(E\). coli is 1000 bp long. (a) Calculate the percentage of \(E\). coli DNA that is not transcribed. (b) Although many mammalian genes are larger than bacterial genes, most mammalian gene products are the same size as bacterial gene products. Calculate the percentage of DNA in exons in the mammalian genome

Problem 4

Assume that, in a rare instance, a typical eukaryotic triose phosphate isomerase gene contains the correct sequences to permit accurate transcription in a prokaryotic cell. Would the resulting RNA be properly translated to yield the intact enzyme?

Problem 5

Describe how the rate of transcription of the lac operon is affected when \(E\). coli cells are grown in the presence of (a) lactose plus glucose, (b) glucose alone, and (c) lactose alone.

Problem 6

In the promoter of the \(E\). coli lac operon the \(-10\) region has the sequence: \(5^{\prime}\)-TATGTT-3'. A mutation named UV5 changes this sequence to: \(5^{\prime}\)-TATAAT-3' (see Figure 21.6). Transcription from the lac UV5 promoter is no longer dependent on the CRP-cAMP complex. Why?

Problem 7

When \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP is incubated with a eukaryotic cell extract that is capable of transcription and RNA processing, where does the label appear in mRNA?

Problem 8

Unlike DNA polymerase, RNA polymerase does not have proofreading activity. Explain why the lack of proofreading activity is not detrimental to the cell.

Problem 9

Mature mRNA from eukaryotic cells is often purified from other components in the cell with the use of columns containing oligo (dT) cellulose. These columns contain short segments of single-stranded deoxyribose thymidylate residues, oligo(dT), attached to a cellulose matrix. Explain the rationale for use of these columns to purify mature mRNA from a mixture of components.

Problem 11

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

Problem 13

In general, if we know the genomic DNA sequence of a gene we can reliably predict the nucleotide sequence of the RNA encoded by that gene. Is this statement also true for tRNAs in prokaryotes? What about tRNAs in eukaryotes?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks