/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 11 A segment of DNA from the middle... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 21: Problem 11

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

Short Answer

Expert verified
The mRNA sequence in the given direction is GGCCGAUUCUAGACUGAUCG and in the reverse direction is CGAUCUCGUAAGCCAUCGGC.

Step by step solution

01

Recall the Base Pair Rules

In DNA, Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). In RNA, Uracil (U) replaces Thymine (T). So, in the process of transcription from DNA to RNA, Adenine in DNA pairs with Uracil in RNA.
02

Transcription in the Given Direction

To transcribe the given DNA sequence (CCGGCTAAGATCTGACTAGC) into mRNA, replace each DNA base with the corresponding RNA base. For the given sequence, this results in the following: for the C's in the DNA sequence, G's are substituted in the RNA sequence. For G's in DNA, C's are substituted. For A's in DNA, U's are substituted, and for T's, A's are substituted. This results in the mRNA sequence: GGCCGAUUCUAGACUGAUCG.
03

Transcription in the Reverse Direction

To transcribe in the reverse direction, reverse the sequence AGCTAGTCAGATCTTAGCCG for RNA. Repeat the substitution as done in the previous step to get the mRNA sequence: CGAUCUCGUAAGCCAUCGGC.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

When \(\beta-\left[{ }^{32} \mathrm{P}\right]\)-ATP is incubated with a eukaryotic cell extract that is capable of transcription and RNA processing, where does the label appear in mRNA?

The E. coli genome is approximately \(4600 \mathrm{~kb}\) in size and contains about 4000 genes. The mammalian genome is approximately \(3 \times 10^{6} \mathrm{~kb}\) in size and contains at most 50000 genes. An average gene in \(E\). coli is 1000 bp long. (a) Calculate the percentage of \(E\). coli DNA that is not transcribed. (b) Although many mammalian genes are larger than bacterial genes, most mammalian gene products are the same size as bacterial gene products. Calculate the percentage of DNA in exons in the mammalian genome

In general, if we know the genomic DNA sequence of a gene we can reliably predict the nucleotide sequence of the RNA encoded by that gene. Is this statement also true for tRNAs in prokaryotes? What about tRNAs in eukaryotes?

Assume that, in a rare instance, a typical eukaryotic triose phosphate isomerase gene contains the correct sequences to permit accurate transcription in a prokaryotic cell. Would the resulting RNA be properly translated to yield the intact enzyme?

A deletion in one of the introns in the gene for the triose phosphate isomerase moves the branch site to a new location 7 nucleotides away from the \(3^{\prime}\)-splice acceptor sequence. Will this deletion have any affect on splicing of the gene?
See all solutions

Recommended explanations on Chemistry Textbooks

Chemical Analysis

Read Explanation

Chemical Reactions

Read Explanation

Organic Chemistry

Read Explanation

Nuclear Chemistry

Read Explanation

Physical Chemistry

Read Explanation

The Earths Atmosphere

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.