/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 11 A segment of DNA from the middle... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

Short Answer

Expert verified
The mRNA sequence in the given direction is GGCCGAUUCUAGACUGAUCG and in the reverse direction is CGAUCUCGUAAGCCAUCGGC.

Step by step solution

01

Recall the Base Pair Rules

In DNA, Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). In RNA, Uracil (U) replaces Thymine (T). So, in the process of transcription from DNA to RNA, Adenine in DNA pairs with Uracil in RNA.
02

Transcription in the Given Direction

To transcribe the given DNA sequence (CCGGCTAAGATCTGACTAGC) into mRNA, replace each DNA base with the corresponding RNA base. For the given sequence, this results in the following: for the C's in the DNA sequence, G's are substituted in the RNA sequence. For G's in DNA, C's are substituted. For A's in DNA, U's are substituted, and for T's, A's are substituted. This results in the mRNA sequence: GGCCGAUUCUAGACUGAUCG.
03

Transcription in the Reverse Direction

To transcribe in the reverse direction, reverse the sequence AGCTAGTCAGATCTTAGCCG for RNA. Repeat the substitution as done in the previous step to get the mRNA sequence: CGAUCUCGUAAGCCAUCGGC.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.