/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 Why are mutations within an intr... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 21: Problem 16

Why are mutations within an intron of a protein-coding gene sometimes detrimental?

Short Answer

Expert verified
Mutations in introns of a protein-coding gene can sometimes be detrimental because they might affect splicing signals, which are important for the correct assembly and functioning of the protein. Incorrect splicing can potentially lead to diseases.

Step by step solution

01

Understand Introns

Introns are segments of DNA located between exons in a gene. They don't contain the code for producing amino acids, and are usually removed during the process of RNA splicing, after transcription but before translation into a protein.
02

Understand Mutations

A mutation is a change in the DNA sequence. Mutations can occur anywhere in the DNA, including within introns. They can be of different types like deletion, insertion, or substitution.
03

Detrimental Effects of Mutations in Introns

While introns don't directly code for amino acids, they play important roles in regulating gene expression. Some mutations in introns can affect splicing signals, changing the way exons are joined together and thereby altering the final protein structure. This could hinder the proper functioning of the gene and could lead to diseases.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

CRP-cAMP represses transcription of the \(c r p\) gene. Predict the location of the CRP-cAMP binding site relative to the promoter of the crp gene.

A deletion in one of the introns in the gene for the triose phosphate isomerase moves the branch site to a new location 7 nucleotides away from the \(3^{\prime}\)-splice acceptor sequence. Will this deletion have any affect on splicing of the gene?

A bacterial RNA polymerase elongates RNA at a rate of 70 nucleotides per second, and each transcription complex covers 70 bp of DNA. (a) What is the maximum number of RNA molecules that can be produced per minute from a gene of \(6000 \mathrm{bp}\) ? (Assume that initiation is not rate-limiting.) (b) What is the maximum number of transcription complexes that can be bound to this gene at one time?

Assume that, in a rare instance, a typical eukaryotic triose phosphate isomerase gene contains the correct sequences to permit accurate transcription in a prokaryotic cell. Would the resulting RNA be properly translated to yield the intact enzyme?
See all solutions

Recommended explanations on Chemistry Textbooks

The Earths Atmosphere

Read Explanation

Chemistry Branches

Read Explanation

Kinetics

Read Explanation

Chemical Analysis

Read Explanation

Making Measurements

Read Explanation

Nuclear Chemistry

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.