/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 RNase T1 cleaves RNA after \(\ma... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 19: Problem 15

RNase T1 cleaves RNA after \(\mathrm{G}\) residues to leave a \(3^{\prime}\) phosphate group. Predict the cleavage products of this substrate: $$ \text { pppApCpUpCpApUpApGpCpUpApUpGpApGpU } $$

Short Answer

Expert verified
The cleavage products of the substrate by RNase T1 are \(pppApCpUpCpApUpA\), \(pGpCpUpApUp\), \(pGpA\) and \(pGpU\).

Step by step solution

01

Identify the RNA sequence

Our given RNA sequence is \(pppApCpUpCpApUpApGpCpUpApUpGpApGpU\). In this sequence, 'p' stands for phosphate group and the other letters 'A', 'C', 'U', 'G' represent the nucleotides: adenine (A), cytosine (C), uracil (U) and guanine (G).
02

Recognize the cleavage activity of RNase T1

The enzyme RNase T1 has a specific effect according to which it cleaves the RNA after G nucleotide, leaving a 3' phosphate group after it.
03

Apply the function to the RNA sequence

Applying this function to our RNA sequence, we can split the sequence at every G nucleotide. However, after each G, a 3' phosphate group is left (\(pG\)) explaining the \(p\) after each \(G\) in the given sequence. Therefore, the sequence will be divided into the following segments: \(pppApCpUpCpApUpA\), \(pGpCpUpApUp\), \(pGpA\), and \(pGpU\).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

How could bacteriophages escape the effects of bacterial restriction endonucleases?

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.

Poly A forms a single-stranded helix. What forces stabilize this structure?

A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by the following enzymes: (a) a \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage (b) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(5^{\prime}\) ester bond of a phosphodiester linkage (c) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage

A stretch of double-stranded DNA contains \(1000 \mathrm{bp}\), and its base composition is \(58 \%(\mathrm{G}+\mathrm{C})\). How many thymine residues are in this region of DNA?
See all solutions

Recommended explanations on Chemistry Textbooks

Ionic and Molecular Compounds

Read Explanation

Kinetics

Read Explanation

Physical Chemistry

Read Explanation

Inorganic Chemistry

Read Explanation

Chemical Analysis

Read Explanation

Chemical Reactions

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.