/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 5 Poly A forms a single-stranded h... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 19: Problem 5

Poly A forms a single-stranded helix. What forces stabilize this structure?

Short Answer

Expert verified
The structure of Poly A, a single-stranded helix, is stabilized by non-covalent interactions, such as hydrogen bonding, van der Waals forces and stacking interactions.

Step by step solution

01

Understand the helical structure

A helical structure is a shape that twists or coils like a spiral. The structure of Poly A is a single-stranded helix, similar to the structure of DNA or RNA.
02

Identify the stabilizing forces

The forces that stabilize the structure of Poly A are primarily non-covalent interactions. These involve hydrogen bonding, van der Waals forces and stacking interactions.
03

Explain the effect of each force

Hydrogen bonds often form between the bases in the helix, holding the strand in a spiral shape. Van der Waals forces, which are weak electric forces, contribute to the stability by allowing the atoms to stay close together. Stacking interactions occur between the bases, which further stabilizes the helical structure.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.

A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by the following enzymes: (a) a \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage (b) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(5^{\prime}\) ester bond of a phosphodiester linkage (c) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage

One of the proteins in rattlesnake venom is an enzyme named phosphodiesterase. Could polynucleotides be a substrate for this enzyme? Why or why not?

(a) Do the two complementary strands of a segment of DNA have the same base composition? (b) Does \((\mathrm{A}+\mathrm{G})\) equal \((\mathrm{C}+\mathrm{T})\) ?

How could bacteriophages escape the effects of bacterial restriction endonucleases?
See all solutions

Recommended explanations on Chemistry Textbooks

The Earths Atmosphere

Read Explanation

Nuclear Chemistry

Read Explanation

Chemical Analysis

Read Explanation

Ionic and Molecular Compounds

Read Explanation

Chemistry Branches

Read Explanation

Organic Chemistry

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.