Chapter 19: Problem 16
How could bacteriophages escape the effects of bacterial restriction endonucleases?
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 19: Problem 16
How could bacteriophages escape the effects of bacterial restriction endonucleases?
All the tools & learning materials you need for study success - in one app.
Get started for free
A non-sequence-specific endonuclease purified from \(A s\) pergillus oryzae digests single-stranded DNA. Predict the effect of adding this enzyme to a preparation of negatively supercoiled plasmid DNA.
RNase T1 cleaves RNA after \(\mathrm{G}\) residues to leave a \(3^{\prime}\) phosphate group. Predict the cleavage products of this substrate: $$ \text { pppApCpUpCpApUpApGpCpUpApUpGpApGpU } $$
Consider a processive exonuclease that binds exclusively to double-stranded DNA and degrades one strand in the \(5^{\prime} \rightarrow 3^{\prime}\) direction. In a reaction where the substrate is a 1 kb fragment of linear DNA, what will be the predominant products after the digestion has gone to completion?
If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.
A stretch of double-stranded DNA contains \(1000 \mathrm{bp}\), and its base composition is \(58 \%(\mathrm{G}+\mathrm{C})\). How many thymine residues are in this region of DNA?
What do you think about this solution?
We value your feedback to improve our textbook solutions.