/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 4 If one strand of DNA has the seq... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.

Short Answer

Expert verified
The complementary DNA sequence for the given sequence ATCGCGTAACATGGATTCGG is TAGCGCATTGTACCTAAGCC.

Step by step solution

01

Identify the complement of each nucleotide

Note each nucleotide in the sequence and its complement. This is guided by the fact that Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C).
02

Write down the sequence of the complementary strand

Replace each nucleotide in the original sequence with its complement. Make sure to check your work to avoid any mistakes.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.