Learning Materials
Features
Discover
Chapter 19: Problem 4
If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.
Over 30 million students worldwide already upgrade their learning with 91影视!
All the tools & learning materials you need for study success - in one app.
Get started for free
Poly A forms a single-stranded helix. What forces stabilize this structure?
(a) Do the two complementary strands of a segment of DNA have the same base composition? (b) Does \((\mathrm{A}+\mathrm{G})\) equal \((\mathrm{C}+\mathrm{T})\) ?
RNase T1 cleaves RNA after \(\mathrm{G}\) residues to leave a \(3^{\prime}\) phosphate group. Predict the cleavage products of this substrate: $$ \text { pppApCpUpCpApUpApGpCpUpApUpGpApGpU } $$
A non-sequence-specific endonuclease purified from \(A s\) pergillus oryzae digests single-stranded DNA. Predict the effect of adding this enzyme to a preparation of negatively supercoiled plasmid DNA.
Consider a processive exonuclease that binds exclusively to double-stranded DNA and degrades one strand in the \(5^{\prime} \rightarrow 3^{\prime}\) direction. In a reaction where the substrate is a 1 kb fragment of linear DNA, what will be the predominant products after the digestion has gone to completion?
What do you think about this solution?
We value your feedback to improve our textbook solutions.
Explanations 
Textbooks 
Flashcards 
91影视 AI 
Notes 
Study Plans 
Study Sets 
Find a degree 
Magazine