/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 14 One of the proteins in rattlesna... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 19: Problem 14

One of the proteins in rattlesnake venom is an enzyme named phosphodiesterase. Could polynucleotides be a substrate for this enzyme? Why or why not?

Short Answer

Expert verified
Yes, polynucleotides, such as DNA and RNA, could indeed be a substrate for the enzyme phosphodiesterase, since they are composed of phosphodiester bonds - the type of bond that this enzyme cleaves.

Step by step solution

01

Identifying the Function of Phosphodiesterase

Phosphodiesterase is an enzyme that breaks down phosphodiester bonds. Phosphodiester bonds are found in many organic compounds, including DNA and RNA.
02

Understanding the Structure of Polynucleotides

Polynucleotides, such as DNA and RNA, are chains of nucleotides. These are composed of three parts: a 5-carbon sugar, a phosphate group, and a nitrogenous base. The phosphate group of one nucleotide is covalently linked to the sugar of the next, forming a repeating pattern of sugar-phosphate-sugar-phosphate. This connection is referred to as a phosphodiester bond.
03

Determining the Connection

Because polynucleotides contain phosphodiester bonds - the very bonds that phosphodiesterase can break - they could indeed serve as a substrate for this enzyme. Given that the enzyme is found in rattlesnake venom, it's plausible that it could have physiological effects that include the degradation of DNA or RNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

(a) Do the two complementary strands of a segment of DNA have the same base composition? (b) Does \((\mathrm{A}+\mathrm{G})\) equal \((\mathrm{C}+\mathrm{T})\) ?

A non-sequence-specific endonuclease purified from \(A s\) pergillus oryzae digests single-stranded DNA. Predict the effect of adding this enzyme to a preparation of negatively supercoiled plasmid DNA.

Consider a processive exonuclease that binds exclusively to double-stranded DNA and degrades one strand in the \(5^{\prime} \rightarrow 3^{\prime}\) direction. In a reaction where the substrate is a 1 kb fragment of linear DNA, what will be the predominant products after the digestion has gone to completion?

A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by the following enzymes: (a) a \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage (b) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(5^{\prime}\) ester bond of a phosphodiester linkage (c) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.
See all solutions

Recommended explanations on Chemistry Textbooks

Chemistry Branches

Read Explanation

Kinetics

Read Explanation

Organic Chemistry

Read Explanation

Chemical Reactions

Read Explanation

Ionic and Molecular Compounds

Read Explanation

Chemical Analysis

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.