/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 29 The following DNA nucleotides ar... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

Short Answer

Expert verified
a. Terminate after 'AAAAA'. b. Rho-independent. c. RNA: 5'- UCGUAUGUCGUCUGGCAACCAGACUUUUUUC -3', includes hairpin structure.

Step by step solution

01

Identify the Terminator Sequence

The sequence given is part of the bacterial DNA. Bacterial transcription termination often involves recognizing specific sequences. Look for a region with an inverted repeat sequence followed by several adenines (A) in the DNA template that's transcribed into uracils (U) on the RNA. The consecutive "AAAAA" in this sequence followed by complementary regions suggests a rho-independent (intrinsic) terminator structure.
02

Determine Termination Point

The rho-independent terminator usually ends after these adenine bases on the DNA template. This means the transcription will terminate after these adenine bases. Consequently, the transcription process will stop at the sequence 'AAAAA', resulting in such u residues in mRNA.
03

Determine the Type of Termination

Given the presence of the inverted repeats followed by a string of adenines, which results in a hairpin loop structure in the RNA during transcription, the termination is rho-independent. Rho-independent terminators involve the formation of a hairpin loop in the RNA leading to destabilization and release of the mRNA transcript.
04

Transcribe RNA from DNA

Transcribe the DNA strand to RNA: replace thymine (T) with uracil (U), and invert orientation for RNA directionality from 5' to 3'. The transcribed RNA will be: 5' - UCGUAUGUCGUCUGGCAACCAGACUUUUUUC - 3'. This RNA reflects transcription excluding the final poly-U sequence indicating termination point.
05

Draw RNA Diagram Including Secondary Structures

The transcribed RNA strand will have a base-pairing complementary to the terminal inverted repeat sequence, typically leading to a hairpin structure. Diagram an RNA strand where the sequence near the end forms a loop with complementary sequences base-pairing to create a hairpin, followed by a short poly-U sequence.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Rho-independent terminator
Rho-independent termination, also known as intrinsic termination, is a method used by bacteria to end the transcription of RNA. Unlike rho-dependent termination, it does not require any additional proteins to stop transcription.
Instead, this mechanism relies on specific sequences within the RNA itself:
  • Inverted repeat sequences followed by a series of uracil bases are crucial.
  • The inverted repeats allow complementary base pairing within the RNA.
  • This base pairing forms secondary structures like the hairpin loop.
After the formation of a hairpin loop, the RNA polymerase pauses and the weak U-A base pairing in the transcription bubble causes the RNA to dissociate from the DNA template, ending transcription.
RNA secondary structure
The RNA secondary structure refers to the shape created by the nucleotide sequences within the RNA molecule due to base pairing. These structures play a significant role in various biological processes, including transcription termination.
Key points about RNA secondary structures include:
  • Formed through hydrogen bonding between complementary bases, specifically cytosine (C) with guanine (G) and adenine (A) with uracil (U).
  • They often materialize as stems and loops.
  • Can significantly affect the RNA's stability and function.
In the context of transcription termination, the secondary structure is crucial for forming the hairpin loop that destabilizes and halts the RNA polymerase.
Inverted repeat sequence
An inverted repeat sequence is a segment of nucleotides in the DNA or RNA that reads the same forwards and backwards when considering its complementary sequence. These sequences are recognizable and play a key role in forming RNA secondary structures.
Their importance in transcription termination includes:
  • Providing the necessary complementarity for the hairpin loop formation.
  • Creating the conditions for RNA folding that are required for rho-independent termination.
The RNA transcribed from these inverted repeats will form a stem structure due to the base pairing, leaving a single-stranded loop at the top, crucial for intrinsic termination mechanisms.
Hairpin loop
The hairpin loop is a common structural feature in RNA molecules that results from the folding of the RNA sequence upon itself.
Here’s how it relates to transcription termination:
  • The hairpin forms immediately downstream of the RNA polymerase as it transcribes the inverted repeat sequence.
  • It's characterized by a double-stranded stem and single-stranded loop.
  • This structure causes physical disruption of the transcription machinery.
When the hairpin loop forms, it induces a pause in RNA polymerase activity. The subsequent weaker uracil-rich sequence (like a string of uracils U's) cannot maintain a stable RNA-DNA hybrid, leading to the release of the RNA.
Transcription termination mechanisms
Bacterial transcription termination can be categorized into two primary mechanisms: rho-dependent and rho-independent termination.
For now, let's focus on how these mechanisms ensure proper gene expression regulation:
  • **Rho-dependent termination** relies on the rho factor protein to help dissociate the RNA molecule from the DNA template.
  • **Rho-independent termination** depends entirely on RNA's secondary structures, like the formation of the hairpin loop.
Regulation of transcription termination ensures that only necessary segments of the RNA are produced. These mechanisms prevent the wasteful synthesis of RNA and help in maintaining cellular efficiency.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.