Chapter 13: Problem 29
The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..
Short Answer
Step by step solution
Identify the Terminator Sequence
Determine Termination Point
Determine the Type of Termination
Transcribe RNA from DNA
Draw RNA Diagram Including Secondary Structures
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Rho-independent terminator
Instead, this mechanism relies on specific sequences within the RNA itself:
- Inverted repeat sequences followed by a series of uracil bases are crucial.
- The inverted repeats allow complementary base pairing within the RNA.
- This base pairing forms secondary structures like the hairpin loop.
RNA secondary structure
Key points about RNA secondary structures include:
- Formed through hydrogen bonding between complementary bases, specifically cytosine (C) with guanine (G) and adenine (A) with uracil (U).
- They often materialize as stems and loops.
- Can significantly affect the RNA's stability and function.
Inverted repeat sequence
Their importance in transcription termination includes:
- Providing the necessary complementarity for the hairpin loop formation.
- Creating the conditions for RNA folding that are required for rho-independent termination.
Hairpin loop
Here’s how it relates to transcription termination:
- The hairpin forms immediately downstream of the RNA polymerase as it transcribes the inverted repeat sequence.
- It's characterized by a double-stranded stem and single-stranded loop.
- This structure causes physical disruption of the transcription machinery.
Transcription termination mechanisms
For now, let's focus on how these mechanisms ensure proper gene expression regulation:
- **Rho-dependent termination** relies on the rho factor protein to help dissociate the RNA molecule from the DNA template.
- **Rho-independent termination** depends entirely on RNA's secondary structures, like the formation of the hairpin loop.