/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 12 How are transcription and replic... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

How are transcription and replication similar, and how are they different?

Short Answer

Expert verified
Transcription and replication are similar in using DNA templates and enzymes, but differ in purpose, products, and their occurrence in cells.

Step by step solution

01

Identify Transcription and Replication

Transcription and replication are two processes that occur within cells to handle genetic information. Transcription is the process by which DNA is used as a template to synthesize RNA, specifically mRNA. Replication, on the other hand, is the process of duplicating the entire DNA molecule to ensure that each daughter cell receives a complete set of genetic instructions during cell division.
02

Explain the Commonalities

Both transcription and replication involve the use of a DNA template. They both go through the unwinding of the DNA double helix to expose the nucleotides. Both processes require the presence of enzymes: RNA polymerase for transcription and DNA polymerase for replication. In addition, both processes occur in the nucleus of eukaryotic cells and are vital for cellular functions.
03

Examine the Differences

Transcription and replication differ in their purpose and what they produce. The purpose of transcription is to create a complementary RNA strand from a DNA sequence, resulting in a usable RNA molecule, while replication aims to create an exact copy of the entire DNA molecule. Transcription usually only involves a particular gene or section of DNA, whereas replication involves the entire genome. Additionally, transcription uses ribonucleotides (A, U, C, G), whereas replication uses deoxyribonucleotides (A, T, C, G). Transcription is a continuous process in the cell, while replication occurs once per cell cycle.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA replication
DNA replication is a critical process in living cells, ensuring that genetic information is passed from one generation of cells to the next. This process takes place during the S-phase of the cell cycle within the nucleus of eukaryotic cells.
During DNA replication, each strand of the double helix serves as a template for the formation of a new complementary strand. Enzymes like DNA helicase unwind the DNA double helix, separating the two strands to allow replication to take place.
Once the strands are separated, DNA polymerase comes into play. This enzyme reads the existing DNA strands and adds complementary nucleotides (A, T, C, G) to form new strands. The result is two identical DNA molecules, each containing one original and one newly synthesized strand, a mechanism known as semi-conservative replication.
Key points about DNA replication include:
  • It ensures genetic continuity in cell division.
  • Involves DNA polymerase for strand synthesis.
  • Occurs only once per cell cycle.
RNA polymerase
RNA polymerase plays a crucial role in the process of transcription, whereby DNA is used as a template to synthesize RNA. It is an enzyme responsible for reading a particular section of the DNA, generally a gene, and assembling an RNA strand based on this template.
The initiation of transcription involves RNA polymerase binding to a specific region of the DNA known as the promoter sequence. This promoter region signals the start of a gene. RNA polymerase then unwinds a small portion of the DNA to access the genetic code.
After unwinding, RNA polymerase selects ribonucleotides that are complementary to the DNA template strand and begins constructing an RNA molecule. This process continues until the enzyme reaches a termination sequence in the DNA, signaling the end of the gene.
Important aspects of RNA polymerase include:
  • It synthesizes RNA from a DNA template.
  • Binds to DNA at the promoter region.
  • Uses ribonucleotides (A, U, C, G).
  • Requires no primer to initiate synthesis.
genetic information handling
Genetic information handling in cells involves multiple processes that ensure DNA is accurately maintained and expressed. Two of these crucial processes are DNA replication and transcription.
In DNA replication, the goal is to preserve the entire genome by creating two identical copies of the DNA molecule for cell division. Meanwhile, transcription focuses on expressing genetic information by creating RNA molecules that can be translated into proteins.
These processes are tightly regulated and occur at specific stages within the cell cycle. While replication occurs during the S-phase, transcription is a continuous process, occurring as needed to produce proteins necessary for cellular functions.
Understanding genetic information handling can be summarized as:
  • Maintaining genetic fidelity during cell division with DNA replication.
  • Converting genetic blueprints into proteins via transcription.
  • Ensures proper cellular function and adaptation to environmental changes.
These processes ensure that genetic information is not only preserved but also effectively used to support the life and growth of the organism.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

Write the consensus sequence for the following set of nucleotide sequences. $$ \begin{array}{l} \text { AGGAGTT } \\ \text { AGCTATT } \\ \text { TGCAATA } \\ \text { ACGAAAA }\\\ \text { TCCTAAT} \\ \text { TGCAATT } \end{array} $$

Draw an RNA nucleotide and a DNA nucleotide, highlighting the differences. How is the structure of RNA similar to that of DNA? How is it different?

Elaborate repair mechanisms that prevent permanent mutations in DNA are associated with replication (see Chapter 18), yet no similar repair process is associated with transcription. Can you think of a reason for this difference between replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule and one in an RNA molecule.)

Glenn Croston and his colleagues studied the relation between chromatin structure and transcription activity. In one set of experiments, they measured the level of in vitro transcription of a Drosophila gene by RNA polymerase II in the presence of DNA and various combinations of histone proteins (G. E. Croston et al. 1991. Science \(251: 643-649\) ). First, they measured the level of transcription of naked DNA, with no associated histone proteins. Then they measured the level of transcription after nucleosome octamers (without \(\mathrm{H} 1\) ) were added to the DNA. The addition of the octamers caused the level of transcription to drop by \(50 \% .\) When both nucleosome octamers and H1 proteins were added to the DNA, transcription was greatly repressed, dropping to less than \(1 \%\) of that obtained with naked DNA, as shown in the following table. GAL4-VP16 is a protein that binds to the DNA of certain eukaryotic genes. When GAL4-VP16 is added to DNA, the level of transcription by RNA polymerase II is greatly elevated. Even in the presence of the H1 protein, GAL4-VP16 stimulates high levels of transcription. Propose a mechanism by which the H1 protein represses transcription and by which GAL4-VP16 overcomes this repression. Explain how your proposed mechanism would produce the results obtained in these experiments.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.