/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 36 Elaborate repair mechanisms that... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Elaborate repair mechanisms that prevent permanent mutations in DNA are associated with replication (see Chapter 18), yet no similar repair process is associated with transcription. Can you think of a reason for this difference between replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule and one in an RNA molecule.)

Short Answer

Expert verified
DNA mutations are permanent and inheritable, while RNA mutations are temporary, so repair mechanisms are prioritized for DNA replication over transcription.

Step by step solution

01

Understanding DNA Replication

DNA replication is the process where a cell duplicates its DNA, resulting in two identical copies. This process is crucial as it ensures that each new cell receives a complete set of genetic instructions. Mistakes during replication can lead to permanent mutations, which, if not corrected, can be passed on to subsequent generations. Hence, the cell has elaborate repair mechanisms to correct any errors during replication.
02

Understanding RNA Transcription

RNA transcription is the process where a segment of DNA is copied into RNA, especially messenger RNA (mRNA), which carries the genetic information to the cell's protein-making machinery. Unlike DNA replication, transcription does not produce a permanent copy and the RNA is often temporary, being degraded after it's used.
03

Analyzing the Impact of Mutations

A mutation in DNA can have long-lasting effects as it can be passed on through cell division and inherited by future generations. In contrast, a mutation in RNA is temporary and affects only the RNA molecule and its immediate functions. Because RNA is transient and not inherited, mutations here have less severe long-term impacts.
04

Explaining the Lack of Repair in Transcription

Since RNA is not a permanent storage of genetic information and is not inherited, cells do not allocate resources to repair transcription errors. If a single RNA molecule is mutated, it generally affects only one protein temporarily, whereas a DNA mutation can potentially affect every future copy of the cell's genome. This is why DNA has elaborate repair mechanisms, whereas RNA does not.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Replication
DNA replication is a vital process that takes place within a cell before it divides. During this process, the cell accurately duplicates its DNA to ensure each new cell gets a full set of genetic instructions. This process is highly precise but not entirely error-free. Mistakes can happen, leading to genetic mutations if they aren't corrected. Such mutations can have serious consequences, as they are heritable through cell division and can persist within a population of cells.

To handle these mistakes, cells possess a variety of repair mechanisms. These include proofreading, where special enzymes check and correct errors during replication. Cells also employ mismatch repair pathways that detect and repair mismatched nucleotides right after DNA replication. These mechanisms protect the integrity of the genetic information that will be passed to future generations, ensuring the proper function and survival of organisms.
RNA Transcription
RNA transcription is the first step in the process of producing proteins from DNA instructions. During transcription, a specific segment of DNA is used as a template to synthesize RNA, most commonly messenger RNA (mRNA). This mRNA will then travel to the ribosome, where protein synthesis occurs. RNA transcription is different from DNA replication, as the RNA produced is a temporary copy that is eventually degraded after its role is fulfilled.

Unlike DNA, errors during RNA transcription are generally less critical. This is because RNA does not serve as a permanent storage of genetic information. Instead, it is a provisional molecule that quickly degrades. Therefore, transcription errors do not have long-lasting consequences, making extensive repair mechanisms economically inefficient for the cell. The transient nature of RNA allows cellular resources to be devoted elsewhere, where they can be more effective.
Genetic Mutations
Genetic mutations are changes in the nucleotide sequence of DNA, which can occur naturally during replication or be induced by environmental factors. Mutations in DNA can be detrimental because they affect the genetic code that the cell relies on to produce proteins. Given that DNA serves as a stable storage for genetic information over the lifespan of an organism, mutations can accumulate and lead to diseases or malfunctions.

In contrast, RNA molecules are not used as long-term genetic repositories. Mutations within RNA mainly impact the synthesis of individual protein molecules, rather than the communal genetic fabric of an organism. This difference explains why cells prioritize DNA repair mechanisms, as errors here could potentially be propagated to progeny, affecting large portions of the organism or even future generations.
Protein Synthesis
Protein synthesis is the process by which cells build proteins, using the instructions encoded in mRNA. This two-stage process involves transcription, where mRNA is created from DNA, followed by translation, where ribosomes convert mRNA into a sequence of amino acids, forming proteins. Proteins are essential for nearly all cellular functions, acting as enzymes, structural components, and signaling molecules.

During protein synthesis, the accuracy of the mRNA template is vital, yet the system tolerates some errors since mRNA can be replaced when it degrades. The cell balances speed and fidelity in protein production, ensuring that it responds efficiently to its environment while maintaining enough accuracy to prevent significant disruptions in protein function.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. $$\begin{array}{cc} \text{A mutation in the gene that codes for}& \text{Effects}\\\ \text{RNA polymerase I}& \---\\\ \text{ RNA polymerase II}& \--- \\ \text{RNA polymerase III}& \--- \end{array} $$ Possible effects a. tRNA is not synthesized. b. Some ribosomal RNA is not synthesized. c. Ribosomal RNA is not processed. d. pre-mRNA is not processed. e. Some mRNA molecules are not degraded. f. pre-mRNA is not synthesized.

How is transcription different in bacteria and eukaryotes? How is it similar?

Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcription factors that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256:1298-1303). Propose some mechanisms other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides away.

Compare the roles of general transcription factors that bind to the core promoter and other transcription factors that bind to the regulatory promoter and enhancers.

The following sequence of nucleotides is found in a singlestranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\), and which end is 3 '? b. Give the sequence and identify the \(5^{\prime}\) and 3 ' ends of the RNA transcribed from this template.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.