/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 18 The following sequence of nucleo... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The following sequence of nucleotides is found in a singlestranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\), and which end is 3 '? b. Give the sequence and identify the \(5^{\prime}\) and 3 ' ends of the RNA transcribed from this template.

Short Answer

Expert verified
a. 3' is left, 5' is right. b. RNA: 5'-UAAUCGGUCAGUAGGGUUAUCUA-3'.

Step by step solution

01

Identify Direction of DNA Template

Since RNA polymerase moves along the DNA template from left to right, the start of the template corresponds to the 3' (prime) end, and the end being approached is the 5' end. Therefore, the sequence ATTGCCAGATCATCCCAATAGAT runs from 3' to 5'.
02

Transcription of RNA Sequence

To write the RNA sequence, complement the DNA template starting from the 3' end. DNA is read to synthesise RNA with adenine converting to uracil, thymine to adenine, cytosine to guanine, and guanine to cytosine. Hence, the RNA sequence becomes: UAAUCGGUCAGUAGGGUUAUCUA.
03

Label RNA Ends

The 5' end of the RNA is the starting point of the newly synthesized strand. Hence, the sequence UAAUCGGUCAGUAGGGUUAUCUA is from the 5' to 3' direction.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Polymerase
RNA polymerase is an essential enzyme in the process of DNA transcription, which is a key step in gene expression. In simple terms, transcription is the process through which the genetic instructions in DNA are converted into a complementary RNA molecule. Here's how RNA polymerase fits into the process:
  • RNA polymerase binds to the DNA template strand at a specific promoter region. This is where transcription begins.
  • Once bound, RNA polymerase moves along the DNA strand from the 3' end toward the 5' end. This movement is crucial for the synthesis of RNA.
  • During this process, RNA polymerase unwinds the DNA double helix, exposing the bases of the template strand.
  • As it progresses, it matches RNA nucleotides with the complementary DNA base pairs to form the RNA strand.
RNA polymerase plays a vital role by ensuring that the RNA transcript is synthesized in a manner complementary to the DNA template. Its ability to initiate and carry out the transcription process makes it indispensable in cell biology.
Nucleotide Sequence
A nucleotide sequence in DNA and RNA is essentially a series of nucleotides, which are the basic building blocks of these molecules. Nucleotides consist of a sugar, a phosphate group, and a nitrogenous base. In DNA, the bases are adenine (A), thymine (T), guanine (G), and cytosine (C). Here's how nucleotide sequences function:
  • In the DNA template strand, sequences dictate the genetic information to be transcribed into RNA.
  • During transcription, the sequence of nucleotides on the DNA determines the sequence of bases in the RNA.
  • When RNA polymerase encounters adenine on the DNA template, it adds uracil (U) to the RNA strand, as uracil takes the place of thymine in RNA.
  • The correct sequence is crucial, as it affects protein synthesis later on in the process.
Thus, each nucleotide sequence is more than just a string of letters—it's a precise code that guides the synthesis of proteins, ultimately affecting the cell's function.
DNA Template Strand
The DNA template strand serves as a blueprint for RNA synthesis during transcription. DNA normally exists as a double-stranded molecule, consisting of two complementary strands coiled into a double helix. The template strand has specific characteristics that play a key role in transcription:
  • This strand runs in a 3' to 5' direction and is used by RNA polymerase to synthesize the RNA strand in a 5' to 3' direction.
  • Only one of the two DNA strands is transcribed. This strand is chosen by RNA polymerase based on the direction of transcription and the gene that needs to be expressed.
  • The template's sequence of bases determines the order of nucleotides in the resulting RNA molecule.
  • This strand is crucial for ensuring that the RNA product accurately reflects the genetic code contained within the DNA molecule.
Understanding the role of the DNA template strand helps in comprehending how genes are expressed and how functions within the cell are regulated.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.

Write the consensus sequence for the following set of nucleotide sequences. $$ \begin{array}{l} \text { AGGAGTT } \\ \text { AGCTATT } \\ \text { TGCAATA } \\ \text { ACGAAAA }\\\ \text { TCCTAAT} \\ \text { TGCAATT } \end{array} $$

What are the three basic stages of transcription? Describe what happens at each stage.

Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. $$\begin{array}{cc} \text{A mutation in the gene that codes for}& \text{Effects}\\\ \text{RNA polymerase I}& \---\\\ \text{ RNA polymerase II}& \--- \\ \text{RNA polymerase III}& \--- \end{array} $$ Possible effects a. tRNA is not synthesized. b. Some ribosomal RNA is not synthesized. c. Ribosomal RNA is not processed. d. pre-mRNA is not processed. e. Some mRNA molecules are not degraded. f. pre-mRNA is not synthesized.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.