/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 19 Assume that a mutation occurs in... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. $$\begin{array}{cc} \text{A mutation in the gene that codes for}& \text{Effects}\\\ \text{RNA polymerase I}& \---\\\ \text{ RNA polymerase II}& \--- \\ \text{RNA polymerase III}& \--- \end{array} $$ Possible effects a. tRNA is not synthesized. b. Some ribosomal RNA is not synthesized. c. Ribosomal RNA is not processed. d. pre-mRNA is not processed. e. Some mRNA molecules are not degraded. f. pre-mRNA is not synthesized.

Short Answer

Expert verified
RNA polymerase I: (b); RNA polymerase II: (d), (e), (f); RNA polymerase III: (a).

Step by step solution

01

Understanding RNA polymerase functions

RNA polymerase I is responsible for synthesizing rRNA, primarily 28S, 18S, and 5.8S. RNA polymerase II synthesizes pre-mRNA, which is the precursor to mRNA, as well as snRNA and miRNA. RNA polymerase III is responsible for synthesizing tRNA and the smallest rRNA, 5S. With these roles in mind, we can match mutations to possible effects.
02

Analyzing RNA polymerase I mutation

Mutation in RNA polymerase I would lead to issues in rRNA synthesis. This means that some ribosomal RNA will not be synthesized, but it would not affect tRNA or pre-mRNA synthesis. Thus, the effect for this mutation is (b) Some ribosomal RNA is not synthesized.
03

Analyzing RNA polymerase II mutation

A mutation in RNA polymerase II affects pre-mRNA synthesis and processing. This results in pre-mRNA not being synthesized and thus not processed. It can also result in issues with snRNA, affecting RNA processing and degradation of mRNA molecules. Thus, the effects are (d) pre-mRNA is not processed, (e) Some mRNA molecules are not degraded, and (f) pre-mRNA is not synthesized.
04

Analyzing RNA polymerase III mutation

RNA polymerase III is responsible for tRNA and 5S rRNA synthesis. A mutation here leads to a failure in synthesizing tRNA. Therefore, the effect for a mutation in RNA polymerase III is (a) tRNA is not synthesized.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Gene Mutation
Gene mutations refer to changes in the nucleotide sequence of the DNA within a gene. These mutations can occur spontaneously, or they can be induced by external factors like radiation or chemicals. The impact of a gene mutation largely depends on the type of change and the location within the gene. Some actions that can lead to mutations include:
  • Substituting one nucleotide for another.
  • Inserting or deleting nucleotides.
  • Disruptions that affect gene regulation.
A mutation in genes encoding RNA polymerases can have significant downstream effects, as RNA polymerases are essential for the transcription of genes into RNA. For example, a mutation in the gene for RNA polymerase II could prevent the synthesis of pre-mRNA, affecting the production of proteins throughout the organism. In summary, gene mutations can have profound effects on cellular processes and organismal functions.
Transcription Process
The transcription process is a key step in gene expression where the information encoded in a gene is used to synthesize RNA molecules. The enzyme RNA polymerase plays a crucial role in this process by reading the DNA template and assembling a complementary RNA strand. Here's how transcription generally unfolds:
  • Initiation: RNA polymerase binds to the DNA at promotor regions to start RNA synthesis.
  • Elongation: RNA polymerase travels along the DNA, synthesizing RNA by adding nucleotides complementary to the DNA template.
  • Termination: Transcription stops when RNA polymerase reaches a termination signal on the DNA, releasing the newly synthesized RNA.
During transcription, different types of RNA molecules are produced, such as mRNA, tRNA, and rRNA, each serving distinct functions in the cell. It's fundamental in cellular function and occurs in all living organisms, serving as a bridge between DNA and protein synthesis. RNA polymerase mutations can disrupt this process, leading to problems in RNA and protein synthesis.
RNA Synthesis
RNA synthesis is a biochemical process involving the creation of RNA molecules from DNA templates. It is closely linked with transcription and carried out by RNA polymerase enzymes, which catalyze the synthesis:
  • RNA polymerase I synthesizes ribosomal RNA (rRNA), crucial for ribosome function.
  • RNA polymerase II synthesizes pre-messenger RNA (pre-mRNA), which is processed into mature mRNA for protein translation.
  • RNA polymerase III synthesizes transfer RNA (tRNA) and the smaller 5S rRNA.
These enzymes are therefore vital for protein synthesis and cell function. The process is tightly regulated and correct folding and processing of RNA molecules are essential for their function. When mutations occur in RNA polymerases, it can lead to improper RNA synthesis, affecting protein production and cellular operations. This underlines the importance of RNA synthesis in maintaining the finely-tuned balance of cellular processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Draw an RNA nucleotide and a DNA nucleotide, highlighting the differences. How is the structure of RNA similar to that of DNA? How is it different?

What are the three basic stages of transcription? Describe what happens at each stage.

The following sequence of nucleotides is found in a singlestranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\), and which end is 3 '? b. Give the sequence and identify the \(5^{\prime}\) and 3 ' ends of the RNA transcribed from this template.

Rear-end collisions between replication and transcription (discussed in the introduction to this chapter) are less likely in eukaryotes because the two processes occur at comparable speeds. Bacteria, in contrast, replicate their DNA almost 10 times faster than they carry out transcription. Can you suggest some reasons why bacteria replication is faster than eukaryotic replication?

Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcription factors that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256:1298-1303). Propose some mechanisms other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides away.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.