/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 26 A strain of bacteria possesses a... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A strain of bacteria possesses a temperature-sensitive mutatio in the gene that encodes the sigma factor. The mutant bacteria produce a sigma factor that is unable to bind to RNA polymerase at elevated temperatures. What effect will this mutation have on the process of transcription when the bacteria are raised at elevated temperatures?

Short Answer

Expert verified
The mutation will halt or severely reduce bacterial transcription at elevated temperatures.

Step by step solution

01

Understand Sigma Factor Function

Sigma factors are proteins that play a crucial role in bacterial transcription initiation by binding to RNA polymerase, enabling it to recognize promoter regions and start transcription of genes.
02

Identify the Mutation Effect

The mutation described prevents the sigma factor from binding to RNA polymerase at elevated temperatures. Without binding, RNA polymerase cannot recognize promoters effectively, halting initiation of transcription.
03

Analyze the Impact at Elevated Temperatures

At elevated temperatures, the mutant sigma factor cannot bind to RNA polymerase, leading to a failure in initiating transcription. Therefore, transcription of bacterial genes is significantly reduced or stopped entirely, hindering bacterial function and growth.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Sigma Factor
The sigma factor is a protein essential for starting the transcription process in bacteria. It is specifically known for its ability to bind to the core enzyme of RNA polymerase.
This binding is crucial because it guides the RNA polymerase to the promoter regions of genes. Promoter regions are specific DNA sequences where the transcription of a gene is initiated. Different sigma factors can recognize different promoters, allowing bacteria to express different genes under varying environmental conditions.
Without the correct binding of the sigma factor, RNA polymerase cannot initiate the transcription process efficiently. This makes the sigma factor a key player in regulating which genes are turned on and off in bacterial cells.
Transcription Initiation
Transcription initiation is the first phase of the transcription process where the RNA polymerase enzyme starts synthesizing RNA from a DNA template. In bacteria, this process begins when a sigma factor, together with RNA polymerase, binds to the promoter region of a gene.
This binding is highly specific, meaning that for any given promoter, only a certain sigma factor can direct RNA polymerase to start transcription. Once the promoter is located and bound:
  • The DNA double helix unwinds,
  • The RNA polymerase aligns the first few nucleotides of the RNA chain with the DNA template,
  • Once synthesis starts, the sigma factor is released, allowing RNA polymerase to proceed along the DNA, elongating the RNA chain.
This sequence ensures that the genetic information encoded in DNA is accurately transferred to an RNA molecule.
RNA Polymerase
RNA polymerase is the enzyme responsible for copying DNA into an RNA strand, a process termed transcription. In bacteria, RNA polymerase operates as a holoenzyme, meaning it requires a sigma factor to properly function.
Once the sigma factor binds to the RNA polymerase, it forms a holoenzyme that can recognize and bind to the promoter region of a gene. Think of RNA polymerase as the machine that reads the blueprint of DNA and constructs a new RNA molecule by adding ribonucleotides according to the DNA template.
RNA polymerase must initially latch onto the promoter with the help of sigma; once transcription begins, it continues elongation without the sigma factor. This independence from the sigma is necessary for RNA polymerase to efficiently transcribe long stretches of DNA into RNA.
Temperature-Sensitive Mutation
A temperature-sensitive mutation is a genetic alteration that causes a protein to lose functionality at higher temperatures. In the context of the bacterial strain described, such a mutation affects the sigma factor, impeding its ability to bind to RNA polymerase when temperatures rise.
This is particularly problematic because, without forming a functional holoenzyme (the combination of RNA polymerase and sigma factor), the transcription initiation process is compromised.
At lower, permissive temperatures, the sigma factor can bind to RNA polymerase normally, allowing transcription to proceed. However, at elevated temperatures, the mutant sigma factor becomes less stable or misfolded, failing to perform its critical role. This leads to a significant reduction in gene expression, which can seriously affect cell growth and survival.
The study of temperature-sensitive mutations is crucial, especially in understanding how proteins function under stress and in different environments.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. $$\begin{array}{cc} \text{A mutation in the gene that codes for}& \text{Effects}\\\ \text{RNA polymerase I}& \---\\\ \text{ RNA polymerase II}& \--- \\ \text{RNA polymerase III}& \--- \end{array} $$ Possible effects a. tRNA is not synthesized. b. Some ribosomal RNA is not synthesized. c. Ribosomal RNA is not processed. d. pre-mRNA is not processed. e. Some mRNA molecules are not degraded. f. pre-mRNA is not synthesized.

What are the two basic types of terminators found in bacterial cells? Describe the structure of each type.

Elaborate repair mechanisms that prevent permanent mutations in DNA are associated with replication (see Chapter 18), yet no similar repair process is associated with transcription. Can you think of a reason for this difference between replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule and one in an RNA molecule.)

Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcription factors that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256:1298-1303). Propose some mechanisms other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides away.

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.