/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 23 Most RNA molecules have three ph... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Most RNA molecules have three phosphate groups at the 5 ' end, but DNA molecules never do. Explain this difference.

Short Answer

Expert verified
RNA retains the triphosphate due to its synthesis process, while DNA loses two phosphates as pyrophosphate during synthesis for stability.

Step by step solution

01

Understanding RNA and DNA structure

Both RNA and DNA are nucleic acids, but they have structural differences. RNA is typically single-stranded and often takes different shapes due to its ability to form intramolecular bonds. DNA is double-stranded, forming a stable double helix. These differences influence their function and chemical properties.
02

Nucleotide Triphosphates and RNA Synthesis

RNA synthesis, also known as transcription, begins with ribonucleotide triphosphates, such as ATP, UTP, GTP, and CTP. These nucleotides contain a high-energy triphosphate group that is used during the synthesis process. When an RNA molecule is synthesized, the 5' end of the RNA retains its original triphosphate group.
03

Nature of DNA Synthesis

During DNA synthesis, the nucleotide precursors used are deoxyribonucleotide triphosphates. However, upon incorporation into the DNA strand, the terminal two phosphates are lost as pyrophosphate. This leaves just one phosphate group at the 5' end of DNA.
04

Purpose and Outcome of Phosphate Hydrolysis

The hydrolysis of pyrophosphate into two inorganic phosphate molecules is a highly energetically favorable reaction. This reaction helps to drive DNA polymerization forward, making the addition of nucleotides a one-way process in DNA synthesis.
05

Concluding the Differences

RNA retains the three phosphate groups at its 5' end due to the nature of transcription and because it often functions locally and remains short-lived. DNA, however, integrates only a single phosphate due to the need for stable, long-term storage of genetic information.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Transcription
Transcription is the biological process through which RNA is synthesized from a DNA template. During transcription, an enzyme called RNA polymerase binds to a specific region on the DNA, initiating the formation of a complementary RNA strand. Unlike DNA replication, transcription focuses only on segments of DNA, not the entire molecule.
RNA synthesis proceeds in the 5' to 3' direction, meaning that nucleotides are added to the 3' end of the growing chain. The starting nucleotide of this newly formed RNA retains its three phosphate groups. These triphosphates are essential for the initial stages of RNA synthesis.
Transcription is crucial because it sets the stage for protein synthesis. The RNA produced, called messenger RNA (mRNA), carries genetic information needed for building proteins. Thus, understanding transcription helps us to grasp how genetic information is transferred from DNA to RNA, and subsequently to proteins.
Nucleotide Triphosphates
Nucleotide triphosphates are vital building blocks for both RNA and DNA. In RNA synthesis, ribonucleotide triphosphates (rNTPs), such as ATP, GTP, CTP, and UTP, are used as substrates. These molecules contain a ribose sugar, a nitrogenous base, and three phosphate groups.
The high-energy bonds between these phosphates are crucial for the polymerization process. During the creation of RNA molecules, the energy released from the hydrolysis of these bonds provides the necessary force to add nucleotides to the growing RNA strand.
  • ATP (adenosine triphosphate)
  • GTP (guanosine triphosphate)
  • CTP (cytidine triphosphate)
  • UTP (uridine triphosphate)
Each of these nucleotides plays a role in forming the RNA strand. Their triphosphate nature is what makes RNA synthesis efficient and effective.
Phosphate Hydrolysis
Phosphate hydrolysis is a critical chemical reaction in both RNA and DNA synthesis, involving the breakdown of phosphate groups. It occurs when the high-energy bonds within triphosphate groups are cleaved, releasing energy needed for nucleic acid synthesis.
In DNA synthesis, deoxyribonucleotide triphosphates (dNTPs) are used. When a dNTP is incorporated into the DNA strand, two of the phosphates are released as pyrophosphate. This reaction is highly exergonic, meaning it releases energy.
The subsequent hydrolysis of the pyrophosphate into two inorganic phosphates further drives DNA synthesis forward by making it energetically favorable. This irreversible step ensures that once a nucleotide is added to a DNA strand, it remains securely in place. This is fundamental for the accuracy and efficiency of DNA replication.
DNA Polymerization
DNA polymerization is the synthesis of a DNA strand by adding deoxyribonucleotide triphosphates (dNTPs) to a growing DNA chain. The process occurs during the S phase of the cell cycle and is key to DNA replication.
DNA polymerase, an enzyme, oversees the addition of dNTPs to the 3' end of the DNA strand. Every time a nucleotide is added, a phosphodiester bond forms, and two phosphates are hydrolyzed as pyrophosphate, leaving a single phosphate at the 5' end.
Unlike RNA, the process of DNA polymerization prioritizes the long-term stability and storage of genetic information. Each added nucleotide reinforces the double helix's structural integrity.
  • The remaining monophosphate stabilizes the backbone of DNA.
  • The hydrolysis of pyrophosphate prevents the reverse reaction.
This precise, stable method is why DNA can efficiently carry genetic information across generations.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Enhancers are sequences that affect the initiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcription factors that bind to enhancers usually interact directly with transcription factors at promoters by causing the intervening DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256:1298-1303). Propose some mechanisms other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides away.

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

Write the consensus sequence for the following set of nucleotide sequences. $$ \begin{array}{l} \text { AGGAGTT } \\ \text { AGCTATT } \\ \text { TGCAATA } \\ \text { ACGAAAA }\\\ \text { TCCTAAT} \\ \text { TGCAATT } \end{array} $$

Elaborate repair mechanisms that prevent permanent mutations in DNA are associated with replication (see Chapter 18), yet no similar repair process is associated with transcription. Can you think of a reason for this difference between replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule and one in an RNA molecule.)

Rear-end collisions between replication and transcription (discussed in the introduction to this chapter) are less likely in eukaryotes because the two processes occur at comparable speeds. Bacteria, in contrast, replicate their DNA almost 10 times faster than they carry out transcription. Can you suggest some reasons why bacteria replication is faster than eukaryotic replication?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.