/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 10 What are the two basic types of ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What are the two basic types of terminators found in bacterial cells? Describe the structure of each type.

Short Answer

Expert verified
The two types of bacterial terminators are Rho-dependent and Rho-independent. Rho-dependent require the Rho protein, while Rho-independent rely on RNA structure.

Step by step solution

01

Identify the Two Types of Terminators in Bacterial Cells

In bacterial cells, transcription termination is crucial for ensuring proper gene expression. The two basic types of terminators found are Rho-dependent terminators and Rho-independent (or intrinsic) terminators.
02

Describe Rho-Dependent Terminators

Rho-dependent terminators require the Rho protein to end transcription. The Rho protein binds to a specific site on the nascent RNA, called the rut site, and moves towards the RNA polymerase. Once it catches up to the RNA polymerase, it facilitates the release of the RNA transcript from the DNA template.
03

Describe Rho-Independent Terminators

Rho-independent terminators, also known as intrinsic terminators, rely on specific sequences within the RNA itself to terminate transcription. They usually consist of a G-C rich hairpin in the RNA followed by a run of U's. The hairpin structure destabilizes the DNA-RNA interaction, leading to the disassociation of the polymerase from the DNA and termination of transcription.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Rho-dependent terminators
Rho-dependent terminators play a vital role in bacterial transcription processes. They need the assistance of a special protein known as the Rho protein to effectively terminate transcription. The process begins with the Rho protein binding to a specific sequence on the newly synthesized RNA, which is identified as the "rut" site (an acronym for Rho utilization site).

Upon binding to the rut site, the Rho protein moves toward the RNA polymerase that is synthesizing the RNA from the DNA template. This approach is similar to having a pursuer catching up to a target. When the Rho protein collides with the RNA polymerase, it induces the release of the RNA transcript. This interaction prompts the dissociation of the RNA from the DNA, thus ending the transcription process effectively.

The critical aspect of Rho-dependent terminators is that they heavily rely on the presence and movement of the Rho protein, thus coining the term "Rho-dependent."
Rho-independent terminators
Rho-independent terminators, also referred to as intrinsic terminators, do not require the assistance of any protein factors like the Rho protein to terminate transcription. Instead, they depend on specific sequences within the RNA itself to trigger the termination of transcription.

The hallmark of Rho-independent terminators is a sequence in the RNA that forms a hairpin structure, usually rich in guanine (G) and cytosine (C) bases. This hairpin structure is followed by a sequence of uracil (U) bases. When this secondary structure forms, it destabilizes the association between the DNA and the RNA, effectively causing the RNA polymerase to halt and dissociate from the DNA template.

The key trait of Rho-independent terminators is their inherent capability to terminate transcription purely based on the sequence and structural conformation of the RNA, eliminating the need for auxiliary proteins.
Intrinsic terminators
Intrinsic terminators are fascinating structures in bacterial transcription systems that remarkably function without requiring the help of external proteins. These terminators harness the power of secondary RNA structures to cease the transcription process naturally and efficiently.

They typically undergo the formation of a robust hairpin structure within the RNA strand. This structure, particularly rich in guanine and cytosine pairs, can induce termination on its own. After the hairpin, a stretch of uracil nucleotides often follows, further assisting in destabilizing the bond between the DNA template and the RNA.

Understanding intrinsic terminators highlights the ability of RNA sequences to self-regulate transcription termination, helping to reveal the complexity and elegance of genetic regulation within bacterial cells.
Hairpin structure
A hairpin structure is a special shape that the RNA can fold into, playing a crucial role in transcription termination, especially for Rho-independent terminators. This structure forms when complementary bases within the RNA strand pair and loop back on themselves, forming a "stem-and-loop" or hairpin pattern.

The stem of the hairpin is typically composed of a sequence rich in guanine and cytosine nucleotides. The abundance of G-C pairs ensures a strong bond, providing stability to the hairpin. This structure acts as a signal that obstructs the RNA polymerase, causing it to pause.
  • The loop in the hairpin allows the structure to bend and form the distinctive shape.
  • The stability comes from the strong G-C interactions.
Subsequently, this hairpin structure precedes a sequence of uracils which enhances the termination process. Its formation weakens the association of the newly created RNA with the DNA template, causing the RNA polymerase to release and conclude transcription.
Rho protein
The Rho protein is a significant player in the termination of transcription in bacterial cells, specifically in the process known as Rho-dependent termination. This hexameric protein functions by targeting and binding to specific RNA sequences called "rut sites" present on the newly synthesized RNA strand.

Once the Rho protein is bound to the RNA, it uses its helicase activity to propel itself along the RNA strand. This movement is directional, guided towards the RNA polymerase, the enzyme responsible for RNA synthesis.

The interaction with the RNA polymerase marks the key action of Rho protein. Upon catching up with the polymerase, it disrupts the transcription complex, leading to the release of the RNA transcript. Therefore, the efficient functioning of Rho protein is crucial for halting transcription at the appropriate sites, ensuring that genetic information is accurately expressed.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Many genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or premature termination of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or premature termination. However, when a single round of transcription of these genes takes place in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place and frequently shorten the lengths of the mRNA molecules produced. Most pauses and premature terminations occur whenRNA polymerase temporarily backtracks (i.e., backs up) for one or two nucleotides along the DNA. Experimental findings have demonstrated that most pauses and premature terminations disappear if several RNA polymerases are simultaneously transcribing the DNA molecule. Propose an explanation for this observation of faster transcription and longer mRNAs when the template DNA is being transcribed by multiple RNA polymerases.

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

Draw an RNA nucleotide and a DNA nucleotide, highlighting the differences. How is the structure of RNA similar to that of DNA? How is it different?

The following sequence of nucleotides is found in a singlestranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\), and which end is 3 '? b. Give the sequence and identify the \(5^{\prime}\) and 3 ' ends of the RNA transcribed from this template.

How is transcription different in bacteria and eukaryotes? How is it similar?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.