/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Genetics: A Conceptual Approach Chapter 13 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 14

Rear-end collisions between replication and transcription (discussed in the introduction to this chapter) are less likely in eukaryotes because the two processes occur at comparable speeds. Bacteria, in contrast, replicate their DNA almost 10 times faster than they carry out transcription. Can you suggest some reasons why bacteria replication is faster than eukaryotic replication?

Problem 15

An RNA molecule has the following percentages of bases: \(\mathrm{A}=\) \(23 \%, \mathrm{U}=42 \%, \mathrm{C}=21 \%,\) and \(\mathrm{G}=14 \%\) a. Is this RNA single stranded or double stranded? How can you tell? b. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?

Problem 16

'The following diagram represents DNA that is part of the RNAcoding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcribed from this DNA, and identify the \(5^{\prime}\) and 3 ends of the RNA. 5'-ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' \(\leftarrow\) Template strand

Problem 18

The following sequence of nucleotides is found in a singlestranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\), and which end is 3 '? b. Give the sequence and identify the \(5^{\prime}\) and 3 ' ends of the RNA transcribed from this template.

Problem 19

Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. $$\begin{array}{cc} \text{A mutation in the gene that codes for}& \text{Effects}\\\ \text{RNA polymerase I}& \---\\\ \text{ RNA polymerase II}& \--- \\ \text{RNA polymerase III}& \--- \end{array} $$ Possible effects a. tRNA is not synthesized. b. Some ribosomal RNA is not synthesized. c. Ribosomal RNA is not processed. d. pre-mRNA is not processed. e. Some mRNA molecules are not degraded. f. pre-mRNA is not synthesized.

Problem 21

Write the consensus sequence for the following set of nucleotide sequences. $$ \begin{array}{l} \text { AGGAGTT } \\ \text { AGCTATT } \\ \text { TGCAATA } \\ \text { ACGAAAA }\\\ \text { TCCTAAT} \\ \text { TGCAATT } \end{array} $$

Problem 23

Most RNA molecules have three phosphate groups at the 5 ' end, but DNA molecules never do. Explain this difference.

Problem 26

A strain of bacteria possesses a temperature-sensitive mutatio in the gene that encodes the sigma factor. The mutant bacteria produce a sigma factor that is unable to bind to RNA polymerase at elevated temperatures. What effect will this mutation have on the process of transcription when the bacteria are raised at elevated temperatures?

Problem 29

The following DNA nucleotides are found near the end of a bacterial transcription unit \(3^{\prime}\) - AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA - 5 ' a. Mark the point at which transcription will terminate. b. Is this terminator rho-independent or rho-dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form..

Problem 30

A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks