Chapter 3: Q26P (page 78)
Draw the tautomeric form of cytosine.
Short Answer
The tautomeric form of cytosine is,

/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 3: Q26P (page 78)
Draw the tautomeric form of cytosine.
The tautomeric form of cytosine is,

All the tools & learning materials you need for study success - in one app.
Get started for free
Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG
Practice drawing the structures of adenine, adenosine, and adenylate.
Question: Identify the purines and pyrimidines commonly found in nucleic acids.
Explain how restriction enzymes generate either sticky ends or blunt ends.
Explain why increasing the NaCl concentration increases the temperature at which the two strands of DNA 鈥渕elt鈥 apart.
What do you think about this solution?
We value your feedback to improve our textbook solutions.