/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q37P Write the sequences of the two 1... [FREE SOLUTION] | 91影视

91影视

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG

Short Answer

Expert verified

The two 12 residue primers are CTGACCAGCGCC and TATCCGTATCCG used to amplify the DNA segment by PCR.

Step by step solution

01

Introduction

The primers are short single-stranded DNA segments that are complementary to the 3藞 end of a polynucleotide, and the DNA polymerase binds the hybridized RNA-DNA duplex. The polymerase is then used to add nucleotides that are complementary to the template strand, lengthening the DNA molecules in a 5藞 to 3藞 direction.

02

Two 12 residue primers are used to amplify the given DNA segment by PCR

The two nitrogen-containing portions of a nucleotide that link together to connect DNA or RNA strands are known as complementary bases. DNA and RNA are both made up of nucleotides, which are complex molecules important in genetics.

The following is the complementary strand of the given sequence:

TATCCGTATCCGGGTATACCGTATTCCGAAATATTATACGCTATCCGCGACCAGTC

The sequence of two 12 residue primers is,

CTGACCAGCGCC and TATCCGTATCCG

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.