/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Fundamentals Of Biochemistry Chapter 3 - (Page 2) [step by step] 9781118918401 | 91Ó°ÊÓ

91Ó°ÊÓ

Chapter 3: Nucleotides, Nucelic Acids, and Genetic Information

Q27P

Page 78

The pK value for N1 of adenine is 3.64, whereas the pK value for N1 of guanine is 9.50. Explain this difference.

Q2CP.

Page 45

Practice drawing the structures of adenine, adenosine, and adenylate.

Q3.

Page 77

In many organisms, DNA is modified by methylation. Draw the structure of 5-methylcytosine, a base that occurs with high frequency in inactive DNA.

Q30P

Page 78

Hypoxanthine can also base-pair with cytosine. Draw the structure of this base pair.

Q35.

Page 78

Describe the possible outcome of a PCR experiment in which (a) one of the primers is inadvertently omitted from the reaction mixture and (b) one of the primers is complementary to several sites in the starting DNA sample.

Q36P.

Page 78

Describe the possible outcome of a PCR experiment in which (a) there is a single-stranded break in the target DNA sequence, which is present in only one copy in the starting sample, and (b) there is a doublestranded break in the target DNA sequence, which is present in only one copy in the starting sample.

Q37P

Page 78

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR.
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG

Q4CP

Page 50

Using Fig. 3-3a as a guide, draw the complete structure of a nucleoside triphosphate before and after it becomes incorporated into a polynucleotide chain. Draw the structure that would result if the newly formed phosphodiester bond were hydrolyzed.

Q5.

Page 77

Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzed reactions?

(a)ATP+GDP→ADP+GTP

(b)ATP+GMP→AMP+GTP


Q6P

Page 77

Question: Kinases are enzymes that transfer a phosphoryl group from a nucleoside triphosphate. Which of the following are valid kinase-catalyzedreactions?
(a)
(b)

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks