Chapter 19: Problem 1
Compare hydrogen bonding in the \(\alpha\) helix of proteins to hydrogen bonding in the double helix of DNA. Include in the answer the role of hydrogen bonding in stabilizing these two structures.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 19: Problem 1
Compare hydrogen bonding in the \(\alpha\) helix of proteins to hydrogen bonding in the double helix of DNA. Include in the answer the role of hydrogen bonding in stabilizing these two structures.
All the tools & learning materials you need for study success - in one app.
Get started for free
How could bacteriophages escape the effects of bacterial restriction endonucleases?
A non-sequence-specific endonuclease purified from \(A s\) pergillus oryzae digests single-stranded DNA. Predict the effect of adding this enzyme to a preparation of negatively supercoiled plasmid DNA.
(a) Do the two complementary strands of a segment of DNA have the same base composition? (b) Does \((\mathrm{A}+\mathrm{G})\) equal \((\mathrm{C}+\mathrm{T})\) ?
A DNA molecule with the sequence pdApdGpdTpdC can be cleaved by exonucleases. List the products of a single reaction catalyzed by the following enzymes: (a) a \(3^{\prime} \rightarrow 5^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage (b) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(5^{\prime}\) ester bond of a phosphodiester linkage (c) a \(5^{\prime} \rightarrow 3^{\prime}\) exonuclease that cleaves the \(3^{\prime}\) ester bond of a phosphodiester linkage
If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.
What do you think about this solution?
We value your feedback to improve our textbook solutions.