/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 8 Most amino acids have more than ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Most amino acids have more than one codon and attach to more than one tRNA, each with a different anticodon. Write all possible anticodons for the four codons of glycine: \(\left(5^{\prime}\right) \mathrm{GGU}, \mathrm{GGC}, \mathrm{GGA}\) and GGG. (a) From your answer, which of the positions in the anticodons are primary determinants of their codon specificity in the case of glycine? (b) Which of these anticodon-codon pairings has/have a wobbly base pair? (c) In which of the anticodon-codon pairings do all three positions exhibit strong Watson-Crick hydrogen bonding?

Short Answer

Expert verified
(a) First and second positions are primary determinants. (b) None; no wobbly base pair needed. (c) CCG-GGC and CCC-GGG show strong bonding.

Step by step solution

01

Understanding Codons and Anticodons

Codons are sequences of three nucleotides on mRNA that code for a specific amino acid during protein synthesis. The anticodon is a sequence of three nucleotides forming a unit on tRNA, complementary to the mRNA codon, which allows the tRNA to bring the correct amino acid to the ribosome during translation.
02

Identifying Codons for Glycine

The four mRNA codons for glycine are GGU, GGC, GGA, and GGG. These codons must pair with the complementary anticodons on the tRNA molecules that carry glycine.
03

Writing Complementary Anticodons

To find the anticodons, we need to determine the complementary bases for the codons and reverse the sequence, as tRNA anticodons bind antiparallel to mRNA. The complementary bases are: - GGU on mRNA pairs with CCA on tRNA. - GGC pairs with CCG. - GGA pairs with UCC. - GGG pairs with CCC.
04

Identifying Primary Determinants of Codon Specificity

In the anticodon, the third position is usually the wobbly position, allowing for flexibility in base-pairing. Here, we analyze the first and second positions which are primary determinants for each anticodon because changes in these positions alter which codon they can recognize (CCA, CCG, UCC, CCC).
05

Identifying Wobbly Base Pairing

The wobble base is the 3rd base of the anticodon, corresponding to the 1st base of the codon. In glycine, pairing can happen with some flexibility, especially when the 3rd base of the anticodon is a U or a G, allowing for non-standard pairings with A or C, respectively. None of the given anticodons (CCA, CCG, UCC, CCC) require a wobbly pairing as the base G or C allows for strong pairing.
06

Identifying Strong Watson-Crick Hydrogen Bonding

Strong Watson-Crick hydrogen bonding occurs when all the positions of the anticodon pair using canonical pairing rules (A with U, G with C). Anticodons like CCG, CCC for the respective codons GGC and GGG show strong pairing in all three positions without wobble.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Codons and Anticodons
In the genetic code, a codon is a sequence of three nucleotides found on messenger RNA (mRNA) that corresponds to a specific amino acid or stop signal during protein synthesis. Each codon is essentially a word in the genetic language that spells out the blueprint for proteins.
Anticodons are the counterparts of codons and play a critical role in the translation process. They are sequences of three nucleotides found on transfer RNA (tRNA) molecules. Each tRNA matches with a specific mRNA codon through base-pairing, allowing it to deliver the correct amino acid to the growing polypeptide chain at the ribosome. This matching is precise due to the complementary nature of the bases involved, where adenine (A) pairs with uracil (U), and cytosine (C) pairs with guanine (G).
To determine the anticodons for the codons of glycine, the nucleotide sequence of the mRNA codon is first identified and then the complementary bases are written in reverse order. For instance:
  • For the mRNA codon GGU, the anticodon is CCA.
  • For GGC, the anticodon is CCG.
  • GGA corresponds to UCC.
  • Finally, GGG matches with CCC.
In these matches, the first two bases of the anticodon are critical as they determine the codon's specificity. This specificity ensures that the correct amino acid is added to the protein structure.
Protein Synthesis
Protein synthesis is a fundamental biological process that turns the instructions in genes into particular proteins. It occurs in two main stages: transcription and translation.
During transcription, a segment of DNA is copied into mRNA. This mRNA then travels from the cell nucleus to a ribosome, where translation takes place.
At the ribosome, the mRNA codons are read in sequence. As each codon is read, a complementary tRNA bearing the corresponding anticodon base-pairs with the mRNA. This brings the right amino acid into position, which the ribosome stitches into the growing polypeptide chain.
This process continues for each codon on the mRNA until the entire protein is assembled and a stop codon is reached, signaling the end of protein synthesis. The precision of this process is essential as even a small error could result in a malfunctioning or entirely different protein. The role of codons and anticodons as molecular matchmakers is central to this accuracy, ensuring that genetic instructions are followed to the letter.
Wobble Hypothesis
The wobble hypothesis is a concept in molecular biology that explains how some tRNA molecules can recognize more than one mRNA codon, due to flexible base-pairing rules at the third position of the codon, known as the wobble position.
According to this hypothesis, the third base of the tRNA anticodon can form hydrogen bonds with more than one kind of base in the third position of a codon. This flexibility arises because certain nucleotide bases can form non-standard pairs with others. For example, inosine, a modified form of adenine in tRNA, can pair with U, C, and A, allowing a single tRNA to read multiple codons differing in their third base.
In the case of glycine's codons (GGU, GGC, GGA, GGG), the wobble position is relevant in interactions, particularly with the anticodons that pair with these codons. Usually, the third nucleotide base of the mRNA codon can tolerate variation, which means that the tRNA anticodon can accommodate this through its wobble flexibility.
This wobble allows the genetic code to be read accurately and efficiently without needing a unique tRNA molecule for every single codon, thus optimizing the protein synthesis process in cells.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The gene for a eukaryotic polypeptide 300 amino acid residues long is altered so that a signal sequence recognized by SRP occurs at the polypeptide's amino terminus and a nuclear localization signal (NLS) occurs internally, beginning at residue \(150 .\) Where is the protein likely to be found in the cell?

The following RNA sequence represents the beginning of an open reading frame. What changes (if any) can occur at each position without generating a change in the encoded amino acid residue? \(\left(5^{\prime}\right)\) AUGAUAUUGCUAUCUUGGACU

The secreted bacterial protein OmpA has a pre-cursor, ProOmpA, which has the amino-terminal signal sequence required for secretion. If purified ProOmpA is denatured with 8 m urea and the urea is then removed (such as by running the protein solution rapidly through a gel filtration column), the protein can be translocated across isolated bacterial inner membranes in vitro. However, translocation becomes impossible if ProOmpA is first allowed to incubate for a few hours in the absence of urea. Furthermore, the capacity for translocation is maintained for an extended period if ProOmpA is first incubated in the presence of another bacterial protein called trigger factor. Describe the probable function of this factor.

Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea about the number of possible mRNAs that can code for one polypeptide.

The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.