/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 Write all the possible mRNA sequ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Write all the possible mRNA sequences that can code for the simple tripeptide segment Leu-Met-Tyr. Your answer will give you some idea about the number of possible mRNAs that can code for one polypeptide.

Short Answer

Expert verified
There are 12 possible mRNA sequences for Leu-Met-Tyr.

Step by step solution

01

Identify Amino Acid Codons

First, we need to identify the codons for each amino acid in the tripeptide Leu-Met-Tyr. Leucine (Leu) can be coded by the codons UUA, UUG, CUU, CUC, CUA, or CUG. Methionine (Met) is coded by the single codon AUG. Tyrosine (Tyr) can be coded by the codons UAU or UAC.
02

Combine Codons for Tripeptide Sequence

To determine all possible mRNA sequences, we must combine the codons for Leu, Met, and Tyr in their respective order. Begin with the six possible codons for Leu, combine each one with the single codon for Met, and then pair each combination with the two possible codons for Tyr.
03

Calculate the Total Number of Sequences

Calculate the total number of mRNA sequences by multiplying the number of codons for each amino acid in the sequence: Leu (6 codons) × Met (1 codon) × Tyr (2 codons). This results in 6 × 1 × 2 = 12 possible mRNA sequences.
04

List All Possible mRNA Sequences

List each possible mRNA sequence: 1. UUA-AUG-UAU 2. UUA-AUG-UAC 3. UUG-AUG-UAU 4. UUG-AUG-UAC 5. CUU-AUG-UAU 6. CUU-AUG-UAC 7. CUC-AUG-UAU 8. CUC-AUG-UAC 9. CUA-AUG-UAU 10. CUA-AUG-UAC 11. CUG-AUG-UAU 12. CUG-AUG-UAC

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Tripeptide Sequence
A tripeptide sequence refers to a chain composed of three amino acids linked together by peptide bonds. In the given exercise, the tripeptide sequence is Leu-Met-Tyr, which stands for Leucine, Methionine, and Tyrosine, respectively. Each of these amino acids has specific codons on the mRNA, which instruct the ribosome to add the corresponding amino acid to the growing peptide chain. Tripeptide sequences are fundamental components in proteins that perform myriad critical functions in living organisms.
To determine the exact sequence of a tripeptide, one needs to know the sequence of mRNA codons because proteins are synthesized based on these instructions. For Leu, there are six possible codons (UUA, UUG, CUU, CUC, CUA, CUG), while Met is represented by a single codon (AUG), and Tyr is coded by two possible codons (UAU, UAC). By combining these, we calculate all potential mRNA sequences that code for the tripeptide Leu-Met-Tyr.
Amino Acid Codons
Amino acids are the building blocks of proteins, and each is encoded by specific mRNA codons. Codons are sequences of three nucleotides that correspond to a specific amino acid. The genetic code is "degenerate" because multiple codons can encode the same amino acid. For example, Leucine (Leu) is encoded by six different codons: UUA, UUG, CUU, CUC, CUA, and CUG. This redundancy helps safeguard against mutations, as changes in the genetic code might not necessarily alter the protein sequence.
Methionine (Met) has a single codon, AUG, which also serves as the start codon for protein synthesis. It signals the beginning of the translation process to form a new protein. Tyrosine (Tyr) is encoded by two codons: UAU and UAC. Due to this genetic redundancy, there can be multiple mRNA sequences coding for the same amino acid sequence, as seen with our Leu-Met-Tyr tripeptide combination.
Understanding codons and the concept of the genetic code is crucial for comprehending how proteins are biosynthesized from mRNA sequences. It allows for the decoding of genetic material into functional proteins.
Polypeptide Synthesis
Polypeptide synthesis is the process of creating long chains of amino acids that fold into functional proteins. This is achieved through translation, where the sequence of mRNA codons is converted into a sequence of amino acids. The ribosome reads the mRNA three nucleotides at a time, each triplet being a codon that specifies a particular amino acid.
During polypeptide synthesis, the ribosome starts translating from the start codon AUG, synthesizing the protein until a stop codon is reached. The tripeptide Leu-Met-Tyr demonstrates this process on a smaller scale, where each step of the synthesis is governed by specific codons. For example, the tripeptide would begin with the ribosome binding to the mRNA at any of Leu's codons, continue with AUG for Met, and finish with one of Tyr's codons.
This precise process ensures that proteins are synthesized accurately, folding into structures required for their specific biological functions. The translation of mRNA into protein is a fundamental cellular process, pivotal for life as it builds proteins that are essential for everything from structural integrity to enzymatic activity.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Some aminoacyl-tRNA synthetases do not recognize and bind the anticodon of their cognate tRNAs but instead use other structural features of the tRNAs to impart binding specificity. The tRNAs for alanine apparently fall into this category. (a) What features of \(t R N A^{\text {Ala }}\) are recognized by Ala-tRNA synthetase? (b) Describe the consequences of a \(\mathrm{C} \rightarrow \mathrm{G}\) mutation in the third position of the anticodon of tRNA \(^{M_{2}}\) (c) What other kinds of mutations might have similar effects? (d) Mutations of these types are never found in natural populations of organisms. Why? (Hint: Consider what might happen both to individual proteins and to the organism as a whole.)

The isoleucyl-tRNA synthetase has a proofreading function that ensures the fidelity of the aminoacylation reaction, but the histidyl-tRNA synthetase lacks such a proofreading function. Explain.

The gene for a eukaryotic polypeptide 300 amino acid residues long is altered so that a signal sequence recognized by SRP occurs at the polypeptide's amino terminus and a nuclear localization signal (NLS) occurs internally, beginning at residue \(150 .\) Where is the protein likely to be found in the cell?

The template strand of a segment of double-helical DNA contains the sequence \(\left(5^{\prime}\right)\) CTTAACACCCCTGACTTCGCGCCGTCG(3') (a) What is the base sequence of the mRNA that can be transcribed from this strand? (b) What amino acid sequence could be coded by the mRNA in (a), starting from the \(5^{\prime}\) end? (c) If the complementary (nontemplate) strand of this DNA were transcribed and translated, would the resulting amino acid sequence be the same as in (b)? Explain the biological significance of your answer.

Predict the amino acid sequences of peptides formed by ribosomes in response to the following mRNA sequences, assuming that the reading frame begins with the first three bases in each sequence. (a) GGUCAGUCGCUCCUGAUU (b) UUGGAUGCGCCAUAAUUUGCU (c) CAUGAUGCCUGUUGCUAC (d) AUGGACGAA

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.