/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Principles of Genetics Chapter 11 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 12

Match one of the following terms with each of the descriptions given. Terms: (1) sigma ( \(\sigma\) ) factor; (2) \(\operatorname{poly}(\mathrm{A})\) tail; (3) TATAAT; (4) exons; (5) TATAAAA; (6) RNA polymerase III; (7) intron; (8) RNA polymerase \(\mathrm{II}\) (9) heterogeneous nuclear RNA (hnRNA); (10) snRNA; (11) RNA polymerase I; (12) TTGACA; (13) GGCCAATCT (CAAT box). (a) Intervening sequence found in many eukaryotic genes. (b) \(A\) conserved nucleotide sequence (-30) in eukaryotic promoters involved in the initiation of transcription. (c) Small RNA molecules that are located in the nuclei of eukaryotic cells, most as components of the spliceosome, that participate in the excision of introns from nuclear gene transcripts. (d) A sequence (-10) in the nontemplate strand of the promoters of \(E\) coli that facilitates the localized unwinding of DNA when complexed with RNA polymerase. (e) The RNA polymerase in the nucleus that catalyzes the synthesis of all rRNAs except for the small \(5 \mathrm{S}\) rRNA. (f) The subunit of prokaryotic RNA polymerase that is responsible for the initiation of transcription at promoters. (g) \(\operatorname{An} E\). coli promoter sequence located 35 nucleotides upstream from the transcription-initiation site; it serves as a recognition site for the sigma factor. (h) The RNA polymerase in the nucleus that catalyzes the synthesis of the transfer RNA molecules and small nuclear RNAs. (i) A polyadenosine tract 20 to 200 nucleotides long that is added to the \(3^{\prime}\) end of most eukaryotic messenger RNAs. (i) The RNA polymerase that transcribes nuclear genes that encode proteins. (k) \(A\) conserved sequence in the nontemplate strand of eukaryotic promoters that is located about 80 nucleotides upstream from the transcription start site. (1) Segments of a eukaryotic gene that correspond to the sequences in the final processed RNA transcript of the gene. (m) The population of primary transcripts in the nucleus of a eukaryotic cell.

Problem 13

(a) Which of the following nuclear pre-mRNA nucleotide sequences potentially contains an intron? 1) \(5^{\prime}-\) UGACCAUGGCGCUAACACUGCCAAUUGGCAAUACUGACCUGAUAGCAUCAGCCAA-3' 2) \(5^{\prime}-\) UAG UC UCAUC UGUCCAU UGACU UC GAAACUGAAUCGUAACUCCUACGUCUAUGGA-3' 3) \(5^{\prime}\) -UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC-3' 4) \(5^{\prime}\) -UAGCAGUUCUGUCGCCUCGUGGUGCUGCUGGCCCUUCGUCGCUCGGGCUUAGCUA-3' 5) \(5^{\prime}\) -UAGGUUCGCAUUGACGUACUUCUGAAACUACUAACUACUAACGCAUCGAGUCUCAA-3' (b) One of the five pre-mRNAs shown in (a) may undergo RNA splicing to excise an intron sequence. What mRNA nucleotide sequence would be expected to result from this splicing event?

Problem 14

What is the function of the introns in eukaryotic genes?

Problem 15

A particular gene is inserted into the phage lambda chromosome and is shown to contain three introns. (a) The primary transcript of this gene is purified from isolated nuclei. When this primary transcript is hybridized under R-loop conditions with the recombinant lambda chromosome carrying the gene, what will the R-loop structure(s) look like? Label your diagram. (b) The mRNA produced from the primary transcript of this gene is then isolated from cytoplasmic polyribosomes and similarly examined by the R-loop hybridization procedure using the recombinant lambda chromosome carrying the gene. Diagram what the R-loop structure(s) will look like when the cytoplasmic mRNA is used. Again, label the components of your diagram.

Problem 16

A segment of DNA in \(E\). coli has the following sequence of nucleotide pairs: \(3^{\prime}\) -ATGCTACTGCTATTCGCTGTATCG-5' \\[ 111111111111111111111111 \\] \(5^{\prime}-\) TACGATGACGATAAGCGACATAGC-3' When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript if the promoter is located to the left of the sequence shown?

Problem 17

A segment of DNA in \(E\). coli has the following sequence of nucleotide pairs: \(3^{\prime}\) -ATATTACTGCAATGGGCTGTATCG| | | | | | || || || || || || || || || | | 5'- TATAATGACGTTACCCGACATAGC- ATGCTACTGCTATTCGCTGTATCG-5' \\[ 111111111111111111111111 \\] TACGATGACGATAAGCGACATAGC-3' When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?

Problem 18

A segment of DNA in \(E\) coli has the following sequence of nucleotide pairs: \(3^{\prime}\) -AACTGTACGTGCTACCTTGCTGATATTACT 11111111111111111111111111111 5'-TTGACATGCACGATGGAACGACTATAATGA- GCAATGGGCTGTATCGATGCTACTGCTAT-5' 11111111111111111111111111111 CGTTACCCGACATAGCTACGATGACGATA-3' When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?

Problem 20

The genome of a human must store a tremendous amount of information using the four nucleotide pairs present in DNA. What do the Morse code and the language of computers tell us about the feasibility of storing large amounts of information using an alphabet composed of just four letters?

Problem 21

What is the central dogma of molecular genetics? What impact did the discovery of RNA tumor viruses have on the central dogma?

Problem 22

The biosynthesis of metabolite \(X\) occurs via six steps catalyzed by six different enzymes. What is the minimal number of genes required for the genetic control of this metabolic pathway? Might more genes be involved? Why?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks