/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 18 A segment of DNA in \(E\) coli h... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of DNA in \(E\) coli has the following sequence of nucleotide pairs: \(3^{\prime}\) -AACTGTACGTGCTACCTTGCTGATATTACT 11111111111111111111111111111 5'-TTGACATGCACGATGGAACGACTATAATGA- GCAATGGGCTGTATCGATGCTACTGCTAT-5' 11111111111111111111111111111 CGTTACCCGACATAGCTACGATGACGATA-3' When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?

Short Answer

Expert verified
5'-UUGACAUGCACGAUGGAACGACUAUAAUGA'

Step by step solution

01

Identify the Template Strand

In DNA transcription, RNA polymerase synthesizes mRNA from the template strand. Here, the template strand is typically the one that runs 3' to 5'. We assess the given DNA strands: - 3'-to-5' strand: **AACTGTACGTGCTACCTTGCTGATATTACT** - 5'-to-3' strand: **TTGACATGCACGATGGAACGACTATAATGA** These strands follow the given order (sense and antisense strands). Thus, the template strand for mRNA synthesis is the 3' to 5' strand.
02

Transcribe the RNA Sequence

After identifying the template DNA strand, the RNA polymerase synthesizes the mRNA by pairing complementary bases with the template strand, but replacing Thymine (T) with Uracil (U). Therefore, using the template strand: - Template: 3'-AACTGTACGTGCTACCTTGCTGATATTACT - RNA: 5'-UUGACAUGCACGAUGGAACGACUAUAAUGA The resulting mRNA strand is complementary and in the 5' to 3' direction, according to base pairing rules (A-U and C-G).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA polymerase
RNA polymerase is a vital enzyme responsible for transcribing DNA into RNA, particularly mRNA. This process is known as transcription, and it is the first step in gene expression. During transcription, RNA polymerase attaches itself to the DNA molecule at a specific sequence called the promoter. This region is recognized by the polymerase as the starting point for transcription.

RNA polymerase moves along the DNA, unwinding it and using one of the strands as a template to build an RNA sequence. The enzyme reads the DNA in the 3'-to-5' direction and synthesizes RNA in the 5'-to-3' direction. This ability to read and write at different directions is crucial for creating a true copy of the genetic code, albeit in RNA form.

Several types of RNA polymerase exist, especially in eukaryotes, each responsible for synthesizing different types of RNA. But in prokaryotes like \(E\) coli, only one type of RNA polymerase is generally needed to synthesize all RNA types. Whether transcribing genes that code for proteins (mRNA) or other types of RNA (tRNA, rRNA), RNA polymerase is indispensable.
Template strand
In DNA transcription, the template strand plays a critical role as the blueprint from which the RNA is synthesized. DNA consists of two strands, and during transcription, RNA polymerase attaches to one of these strands - the template strand - to build the RNA sequence.

The template strand is the one that runs in a 3'-to-5' direction. This orientation is essential because RNA polymerase synthesizes the new RNA strand in a 5'-to-3' direction, complementarily matching with the nucleotide bases found on the template strand. Because of the base pairing rules (A pairs with U, and C pairs with G in RNA), a mirror image of the template strand's nucleotide sequence is produced, but with Uracil (U) replacing Thymine (T).

In our example, the template strand's sequence is 3'-AACTGTACGTGCTACCTTGCTGATATTACT and was used by RNA polymerase as the reference to synthesize the complementary mRNA strand. Understanding which strand is used as the template is fundamental when predicting the RNA output during transcription.
mRNA synthesis
mRNA synthesis is the process of constructing an RNA strand from the DNA template, specifically creating messenger RNA (mRNA) to convey genetic information from DNA to the ribosome, where protein synthesis occurs.

During transcription, RNA polymerase binds to the DNA template strand and synthesizes mRNA by following the base pairing rules. It does this by replacing the DNA thymine base with uracil in the RNA. For instance, given the template sequence 3'-AACTGTACGTGCTACCTTGCTGATATTACT, RNA synthesis will yield a complementary sequence: 5'-UUGACAUGCACGAUGGAACGACUAUAAUGA.

This newly synthesized mRNA strand carries the genetic blueprint needed for protein synthesis, as it is read in sets of three bases called codons. Each codon corresponds to a specific amino acid or a signal to start or stop protein synthesis. Through mRNA synthesis, information from genes is translated into functional proteins, underpinning the cellular processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Total RNA was isolated from nuclei of human cells growing in culture. This RNA was mixed with a purified, denatured DNA fragment that carried a large intron of a housekeeping gene (a gene expressed in essentially all cells), and the RNA-DNA mixture was incubated for 12 hours under renaturation conditions. Would you expect any RNA-DNA duplexes to be formed during the incubation? If so, why? If not, why not? The same experiment was then performed using total cytoplasmic RNA from these cells. Would you expect any RNA-DNA duplexes to be formed in this second experiment? If so, why? If not, why not?

Two preparations of RNA polymerase from \(E .\) coli are used in separate experiments to catalyze RNA synthesis in vitro using a purified fragment of DNA carrying the argH gene as template DNA. One preparation catalyzes the synthesis of RNA chains that are highly heterogeneous in size. The other preparation catalyzes the synthesis of RNA chains that are all the same length. What is the most likely difference in the composition of the RNA polymerases in the two preparations?

What are the two stages of gene expression? Where do they occur in a eukaryotic cell? a prokaryotic cell?

Compare the structures of primary transcripts with those of mRNAs in prokaryotes and eukaryotes. On average, in which group of organisms do they differ the most?

A particular gene is inserted into the phage lambda chromosome and is shown to contain three introns. (a) The primary transcript of this gene is purified from isolated nuclei. When this primary transcript is hybridized under R-loop conditions with the recombinant lambda chromosome carrying the gene, what will the R-loop structure(s) look like? Label your diagram. (b) The mRNA produced from the primary transcript of this gene is then isolated from cytoplasmic polyribosomes and similarly examined by the R-loop hybridization procedure using the recombinant lambda chromosome carrying the gene. Diagram what the R-loop structure(s) will look like when the cytoplasmic mRNA is used. Again, label the components of your diagram.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.