/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 A segment of DNA in \(E\). coli ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of DNA in \(E\). coli has the following sequence of nucleotide pairs: \(3^{\prime}\) -ATATTACTGCAATGGGCTGTATCG| | | | | | || || || || || || || || || | | 5'- TATAATGACGTTACCCGACATAGC- ATGCTACTGCTATTCGCTGTATCG-5' \\[ 111111111111111111111111 \\] TACGATGACGATAAGCGACATAGC-3' When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?

Short Answer

Expert verified
The RNA transcript will be 5'-UAUAAUGACGUUACCCGACAUAGC-3'.

Step by step solution

01

Understanding DNA Strands

The DNA sequence is given with both strands, the coding strand (or sense strand) and the template strand (or antisense strand). The RNA polymerase uses the template strand to create the complementary RNA strand.
02

Identify Template and Coding Strands

In a DNA double helix, the two strands run in opposite directions: the coding strand (runs 5' to 3') and the template strand (runs 3' to 5'). Here, the second sequence (5' to 3'- TATAATGACGTTACCCGACATAGC) is the coding strand, and the RNA sequence will directly match this, but with Uracil (U) replacing Thymine (T). The first sequence (3' to 5'- ATATTACTGCAATGGGCTGTATCG) is the template strand.
03

Transcribing DNA to RNA

When transcribing the template strand (3' to 5') to RNA, you match A with U, T with A, C with G, and G with C. Therefore, for the sequence 3'-ATATTACTGCAATGGGCTGTATCG-5', the RNA sequence will be 5'-UAUAAUGACGUUACCCGACAUAGC-3'.
04

Determining the RNA Transcript

After transcribing the template strand, the RNA sequence will be 5'-UAUAAUGACGUUACCCGACAUAGC-3'. This is complementary to the template strand and matches the coding strand's sequence but with Uracil instead of Thymine.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA polymerase
RNA polymerase is an enzyme critical to the process of transcription in cells. During transcription, it reads the DNA template strand and synthesizes RNA. This enzyme functions by sliding along the DNA strand, opening up a bubble where it can read the genetic code. As it moves, RNA polymerase constructs an RNA molecule by linking together RNA nucleotides that are complementary to the DNA template.
The key role RNA polymerase plays makes it essential for gene expression, ensuring that the genetic information from DNA is accurately transcribed into RNA, which can then be translated into proteins. It not only initiates the process but also elongates and eventually terminates the RNA transcript. This is a vital step in cellular functions and reproduction.
RNA polymerase operates in a highly regulated environment, where it starts transcription only at specific points on the DNA strand. These starting points are indicated by promoter sequences, which signal RNA polymerase where to begin its work.
Template strand
In the context of DNA transcription, understanding the template strand is crucial. The template strand is also known as the antisense strand. It is the strand of DNA that RNA polymerase reads to synthesize RNA. Since DNA is double-stranded, one strand serves as a pattern for generating the sequence of nucleotides in an RNA molecule.
When transcription begins, RNA polymerase binds to the template strand and starts reading its nucleotides. Each nucleotide on the template strand pairs with a complementary RNA nucleotide. For example, if the template strand has adenine (A), the RNA polymerase will add uracil (U) to the RNA sequence.
This process results in an RNA strand that is complementary to the template strand and nearly identical to the non-template strand, with the exception of uracil substituting for thymine. This precise copying mechanism ensures that the RNA transcript carries the correct genetic instructions for protein synthesis.
Coding strand
The coding strand, also known as the sense strand, is the DNA strand that does not serve as a template for RNA synthesis but resembles the RNA product. It runs in a 5' to 3' direction, opposite to the 3' to 5' orientation of the template strand.
While RNA polymerase actively reads the template strand, it's the sequence of the coding strand that is nearly replicated in the RNA, except for thymine, which is replaced by uracil in RNA. For instance, if the coding strand has a sequence of C-G-T-A, the RNA will have a sequence of C-G-U-A, matching except for the thymine/uracil difference.
The coding strand's primary function is to convey the genetic code that specifies the sequence of amino acids in a protein. It is important to note that the coding strand's sequence is often what scientists refer to when describing a gene's sequence, as it aligns with the eventual RNA and thus the protein-coding instructions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.