/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 A segment of DNA in \(E\). coli ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of DNA in \(E\). coli has the following sequence of nucleotide pairs: \(3^{\prime}\) -ATGCTACTGCTATTCGCTGTATCG-5' \\[ 111111111111111111111111 \\] \(5^{\prime}-\) TACGATGACGATAAGCGACATAGC-3' When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript if the promoter is located to the left of the sequence shown?

Short Answer

Expert verified
The RNA sequence is 5' - AUGCUACUGCUAUUCGCACAUCG - 3'.

Step by step solution

01

Identify the Template Strand

Since the promoter is located to the left of the sequence shown, RNA polymerase will transcribe it starting from the 3' end on the bottom strand of the given sequence. The template strand is the one that is read by the RNA polymerase, which in this case is the bottom strand: \(5' - TACGATGACGATAAGCGACATAGC - 3'\).
02

Determine the RNA Sequence

RNA polymerase synthesizes RNA in the 5' to 3' direction, forming an RNA strand complementary to the template strand. Note that RNA uses uracil (U) instead of thymine (T). - Template Strand: 5' - TACGATGACGATAAGCGACATAGC - 3' - RNA Transcript: - Complementary base to T is A. - Complementary base to A is U. - Complementary base to C is G. - Complementary base to G is C. The RNA sequence becomes 5' - AUGCUACUGCUAUUCGCACAUCGA - 3'.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Polymerase
RNA polymerase is a critical enzyme involved in the process of transcription, the first step in gene expression. Its main function is to read the DNA template and synthesize a complementary RNA strand. Unlike DNA synthesis, which requires a primer to start, RNA polymerase can initiate the synthesis of an RNA molecule on its own.
For transcription to start, RNA polymerase binds to a specific region of the DNA known as the promoter. Once attached, it unwinds the DNA helix to access the template strand. This action sets the stage for the enzyme to "read" the DNA and add the appropriate RNA nucleotides.
RNA polymerase does not require proofreading functions like DNA polymerase because RNA molecules are not permanent carriers of genetic information, and errors are not passed to offspring.
Template Strand
In the transcription process, the template strand is the segment of DNA that serves as the guide for forming the RNA sequence. DNA consists of two strands, but only one is used by RNA polymerase to create the RNA transcript.
Selecting the correct template strand is crucial. The promoter's location typically determines which strand serves as the template. In the original exercise, because the promoter is to the left, the transcription proceeds from the 3' end of the bottom strand.
As the RNA polymerase moves along the DNA template strand, it builds an RNA strand by linking complementary RNA nucleotides; where adenine (A) in DNA pairs with uracil (U) in RNA, and thymine (T) in DNA pairs with adenine (A) in RNA.
RNA Sequence
The RNA sequence is a complementary copy of the DNA template strand, constructed by RNA polymerase during transcription. It is synthesized in the 5' to 3' direction and is a crucial step in the central dogma of molecular biology, wherein DNA gives rise to RNA, which in turn codes for proteins.
During transcription, the sequences of nucleotides on the template DNA strand dictate the sequence of the synthesized RNA. Here's a quick summary of base pairing rules applicable to RNA transcription:
  • Thymine (T) on DNA pairs with Adenine (A) on RNA.
  • Adenine (A) on DNA pairs with Uracil (U) on RNA.
  • Cytosine (C) on DNA pairs with Guanine (G) on RNA.
  • Guanine (G) on DNA pairs with Cytosine (C) on RNA.
These pairings ensure that the genetic code is accurately transcribed into RNA, ready for translation into protein.
E. coli Genetics
E. coli is a commonly studied bacterium in genetics research due to its simple genetic structure and rapid reproduction. Understanding its transcription process provides foundational knowledge applicable to more complex organisms.
In E. coli, DNA transcription starts when RNA polymerase binds to a promoter region, initiating the synthesis of RNA. This model organism's genetics are heavily based on studies of DNA replication, repair, and expression systems.
Due to its simplicity, E. coli serves as an excellent model for understanding basic biological mechanisms such as transcription, making it a staple in molecular genetics. The insights gleaned from E. coli have laid the groundwork for biotechnological advancements, such as the development of recombinant DNA technology.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.