/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 31 Two preparations of RNA polymera... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Two preparations of RNA polymerase from \(E .\) coli are used in separate experiments to catalyze RNA synthesis in vitro using a purified fragment of DNA carrying the argH gene as template DNA. One preparation catalyzes the synthesis of RNA chains that are highly heterogeneous in size. The other preparation catalyzes the synthesis of RNA chains that are all the same length. What is the most likely difference in the composition of the RNA polymerases in the two preparations?

Short Answer

Expert verified
The difference is the presence or absence of the sigma factor.

Step by step solution

01

Understanding the Problem

We are given two experiments involving RNA synthesis catalyzed by RNA polymerase using the same DNA template. One result is heterogeneous RNA, while the other is homogeneous, uniform-length RNA. We need to determine what structural difference in the RNA polymerase might lead to this difference in RNA product.
02

Analyzing RNA Polymerase Structure

RNA polymerase in prokaryotes like \(E. coli\) has several subunits, including a core that synthesizes RNA and a sigma factor that provides specificity for initiation. The core enzyme alone can initiate transcription at any point along the DNA, leading to heterogeneous RNA.
03

Understanding Homogeneous RNA Synthesis

For uniform, homogeneous RNA chain synthesis, the RNA polymerase must initiate transcription specifically at the start of the coding sequence of the argH gene. This specificity is typically provided by a sigma factor bound to the core RNA polymerase.
04

Comparing Heterogeneous and Homogeneous Results

In the first preparation with heterogeneous RNA, the RNA polymerase likely lacks the sigma factor, allowing it to initiate randomly. In the second, the sigma factor is present, guiding the polymerase to a specific initiation site, producing uniform-length RNA chains.
05

Drawing Conclusion

The most likely difference in the RNA polymerase preparations is the presence or absence of the sigma factor. Without the sigma factor, polymerase cannot specifically target the initiation site, leading to varied RNA chain lengths.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

E. coli
The bacterium *Escherichia coli*, commonly abbreviated as *E. coli*, is a well-studied model organism used in molecular biology. This bacterium resides primarily in the intestines of warm-blooded organisms. It is a versatile organism that plays a critical role in research due to its relatively simple genome and rapid replication rate. Scientists often use *E. coli* to study the mechanisms of genetic expression, including RNA synthesis and transcription processes.
*E. coli* has been pivotal in understanding how genes are transcribed and expressed in prokaryotic cells. This understanding helps because *E. coli* shares many fundamental biological processes with more complex organisms. Despite its simplicity, the transcription machinery in *E. coli* is a comprehensive system that allows researchers to draw parallels to more intricate eukaryotic systems.
sigma factor
The sigma factor is a protein critical for the initiation of transcription in bacteria like *E. coli*. It associates with the RNA polymerase core enzyme to form the holoenzyme. This complex is crucial because the sigma factor confers specificity to the otherwise promoter-blind core enzyme. It helps the RNA polymerase recognize specific promoter sequences on the DNA template.
This specificity is essential for ensuring that transcription starts precisely where needed, leading to accurate RNA synthesis. Without the sigma factor, transcription initiation occurs randomly, producing transcripts of varying lengths, as the polymerase would bind non-specifically to the DNA. Thus, the presence or absence of a sigma factor can significantly impact the uniformity and functionality of synthesized RNA.
transcription initiation
Transcription initiation is the process that marks the beginning of RNA synthesis. It involves forming the transcription initiation complex, which consists of the RNA polymerase holoenzyme and the DNA template with the promoter region.
The sigma factor plays a vital role here, as it ensures that RNA polymerase binds stably to the promoter and not just anywhere on the DNA. It effectively positions the polymerase for the start of RNA synthesis at the correct point on the template. This precision is crucial for generating functional RNA molecules that can be translated into proteins.
Transcription initiation is followed by elongation and termination to complete the synthesis of RNA. Proper initiation is vital for the overall fidelity of gene expression.
DNA template
The DNA template in transcription acts as a blueprint from which RNA is synthesized. It comprises two strands, but only one strand serves as the template during transcription, called the template strand. The other strand, known as the coding strand, has a sequence identical to the newly synthesized RNA (except for uracil in RNA replacing thymine in DNA).
The RNA polymerase moves along the template DNA strand, reading its sequence and synthesizing a complementary RNA transcript. This transcript will carry the genetic information needed for protein synthesis. Accurate recognition of the start site on the DNA template by the polymerase holoenzyme, guided by the sigma factor, is critical to ensure the RNA transcript is the correct length and sequence.
RNA synthesis
RNA synthesis, also known as transcription, is the biological process through which RNA molecules are formed from a DNA template. This process is catalyzed by the enzyme RNA polymerase. The enzyme reads the DNA template strand, stringing together RNA nucleotides in a sequence complementary to the DNA template. This event adheres to base-pairing rules specific to nucleic acids.
RNA synthesis creates various types of RNA, including mRNA (messenger RNA), tRNA (transfer RNA), and rRNA (ribosomal RNA), each serving different roles within the cell. The initial steps of RNA synthesis require proper transcription initiation to ensure the RNA produced is accurate and functional. All these elements tie together because they allow the genetic code from DNA to be expressed and used in vital cellular processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Distinguish between DNA and RNA (a) chemically, (b) functionally, and (c) by location in the cell.

What different types of RNA molecules are present in prokaryotic cells? in eukaryotic cells? What roles do these different classes of RNA molecules play in the cell?

What do the processes of DNA synthesis, RNA synthesis, and polypeptide synthesis have in common?

(a) Which of the following nuclear pre-mRNA nucleotide sequences potentially contains an intron? 1) \(5^{\prime}-\) UGACCAUGGCGCUAACACUGCCAAUUGGCAAUACUGACCUGAUAGCAUCAGCCAA-3' 2) \(5^{\prime}-\) UAG UC UCAUC UGUCCAU UGACU UC GAAACUGAAUCGUAACUCCUACGUCUAUGGA-3' 3) \(5^{\prime}\) -UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC-3' 4) \(5^{\prime}\) -UAGCAGUUCUGUCGCCUCGUGGUGCUGCUGGCCCUUCGUCGCUCGGGCUUAGCUA-3' 5) \(5^{\prime}\) -UAGGUUCGCAUUGACGUACUUCUGAAACUACUAACUACUAACGCAUCGAGUCUCAA-3' (b) One of the five pre-mRNAs shown in (a) may undergo RNA splicing to excise an intron sequence. What mRNA nucleotide sequence would be expected to result from this splicing event?

A particular gene is inserted into the phage lambda chromosome and is shown to contain three introns. (a) The primary transcript of this gene is purified from isolated nuclei. When this primary transcript is hybridized under R-loop conditions with the recombinant lambda chromosome carrying the gene, what will the R-loop structure(s) look like? Label your diagram. (b) The mRNA produced from the primary transcript of this gene is then isolated from cytoplasmic polyribosomes and similarly examined by the R-loop hybridization procedure using the recombinant lambda chromosome carrying the gene. Diagram what the R-loop structure(s) will look like when the cytoplasmic mRNA is used. Again, label the components of your diagram.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.