/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 13 (a) Which of the following nucle... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

(a) Which of the following nuclear pre-mRNA nucleotide sequences potentially contains an intron? 1) \(5^{\prime}-\) UGACCAUGGCGCUAACACUGCCAAUUGGCAAUACUGACCUGAUAGCAUCAGCCAA-3' 2) \(5^{\prime}-\) UAG UC UCAUC UGUCCAU UGACU UC GAAACUGAAUCGUAACUCCUACGUCUAUGGA-3' 3) \(5^{\prime}\) -UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC-3' 4) \(5^{\prime}\) -UAGCAGUUCUGUCGCCUCGUGGUGCUGCUGGCCCUUCGUCGCUCGGGCUUAGCUA-3' 5) \(5^{\prime}\) -UAGGUUCGCAUUGACGUACUUCUGAAACUACUAACUACUAACGCAUCGAGUCUCAA-3' (b) One of the five pre-mRNAs shown in (a) may undergo RNA splicing to excise an intron sequence. What mRNA nucleotide sequence would be expected to result from this splicing event?

Short Answer

Expert verified
Sequence 2 contains an intron; spliced mRNA is 'UAGUCAUCGUAACUCCUACGUCUAUGGA'.

Step by step solution

01

Identify Introns in Pre-mRNA

To determine which sequences potentially contain an intron, look for the presence of splice site sequences. Typical 5' splice sites begin with 'GU' and typical 3' splice sites end with 'AG.' From the options given: 1) Sequence 1: Does not clearly show a 'GU...AG' pattern typically found in introns. 2) Sequence 2: Has a section with 'GU...AG' (at ‘UGAC...AAUCGUAAC’), indicating potential intron boundaries. 3) Sequence 3: No clear 'GU...AG' intron sequence. 4) Sequence 4: No clear 'GU...AG' intron sequence. 5) Sequence 5: No clear 'GU...AG' intron sequence. Thus, sequence 2 potentially contains an intron.
02

Perform Splicing on Identified Intron

Given that sequence 2 contains a potential intron (from 'GU' after the start to 'AG' at the end), perform splicing by removing the nucleotides starting with 'GU' and ending with 'AG' within the sequence. Thus, the segment 'UGACUUC...GAUC' is removed from sequence 2.
03

Construct the Spliced mRNA Sequence

After excising the identified intron from sequence 2, concatenate the remaining sequences. Sequence 2 reads from 5' to 3' as 'UAGUC...GAUC'. Remove 'UGACUUC...GAUC', leaving 'UAGUCAUCGUAACUCCUACGUCUAUGGA' as the spliced mRNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

pre-mRNA
The process of RNA splicing begins with an important molecule called pre-mRNA, also known as precursor mRNA. This molecule is the initial transcript that is synthesized during transcription, directly from the DNA template. Pre-mRNA is an immature form of mRNA and contains both coding regions, called exons, and non-coding regions, known as introns.
This structure highlights the need for mRNA processing to remove the non-essential segments, making it ready for translation into proteins.
  • The length and complexity of pre-mRNA can vary greatly.
  • It undergoes several modifications before becoming mature mRNA, which include capping, polyadenylation, and splicing.
  • Without processing, the pre-mRNA would not be functional for protein synthesis.
As we focus on RNA splicing, it's essential to understand that pre-mRNA is the starting material for this critical process.
introns
Introns are non-coding regions found within a gene's pre-mRNA. These sequences must be accurately removed to produce a functional mRNA molecule that can be translated into a protein. Introns can be quite variable in their size and sequence; however, their removal is crucial because they interrupt the coding sequence of a gene.
Introns often do not encode functional proteins and serve regulatory roles in gene expression and mRNA processing.
  • The removal of introns occurs during RNA splicing.
  • The presence of introns and exons allows for alternative splicing, increasing the diversity of proteins a single gene can produce.
  • Introns are identified and removed based on specific sequences at their boundaries, known as splice sites.
Understanding introns is vital for appreciating how genes can give rise to different protein forms through alternative splicing.
splice sites
Splice sites are consensus sequences at the borders of introns and exons in pre-mRNA. They play a critical role by marking where splicing should occur to remove introns and join exons. Splice sites are generally composed of conserved nucleotide sequences where splicing machinery called the spliceosome acts.
The two key types of splice sites are the 5' donor splice site and the 3' acceptor splice site.
  • The 5' splice site often begins with the nucleotide sequence 'GU' at the intron's end.
  • The 3' splice site typically ends with 'AG' at the intron's end.
  • These sequences are recognized by snRNPs and other proteins that form the spliceosome, ensuring precise removal of intronic regions.
Properly identifying splice sites is crucial, as errors can lead to aberrant splicing and the production of non-functional proteins.
nucleotide sequences
Nucleotide sequences are strings of nucleotides, which are the building blocks of RNA and DNA. Each nucleotide consists of a nitrogenous base, sugar, and phosphate group, and their sequences determine the genetic information carried by a molecule. For RNA splicing, specific nucleotide sequences within pre-mRNA play critical roles.
These sequences are involved in the accurate identification and removal of introns.
  • In pre-mRNA, the sequence of nucleotides helps define the regions to be retained (exons) and those to be removed (introns).
  • Key sequences, including 'GU' and 'AG' at splice sites, dictate where splicing occurs.
  • The proper understanding of these sequences is crucial for ensuring that only the appropriate segments of RNA are spliced.
Thus, nucleotide sequences control the flow of genetic information from DNA to mature RNA, which is then translated into proteins.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What is the function of the introns in eukaryotic genes?

Two eukaryotic genes encode two different polypeptides, each of which is 335 amino acids long. One gene contains a single exon; the other gene contains an intron 41,324 nucleotide pairs long. Which gene would you expect to be transcribed in the least amount of time? Why? When the mRNAs specified by these genes are translated, which mRNA would you expect to be translated in the least time? Why?

What is the central dogma of molecular genetics? What impact did the discovery of RNA tumor viruses have on the central dogma?

Match one of the following terms with each of the descriptions given. Terms: (1) sigma ( \(\sigma\) ) factor; (2) \(\operatorname{poly}(\mathrm{A})\) tail; (3) TATAAT; (4) exons; (5) TATAAAA; (6) RNA polymerase III; (7) intron; (8) RNA polymerase \(\mathrm{II}\) (9) heterogeneous nuclear RNA (hnRNA); (10) snRNA; (11) RNA polymerase I; (12) TTGACA; (13) GGCCAATCT (CAAT box). (a) Intervening sequence found in many eukaryotic genes. (b) \(A\) conserved nucleotide sequence (-30) in eukaryotic promoters involved in the initiation of transcription. (c) Small RNA molecules that are located in the nuclei of eukaryotic cells, most as components of the spliceosome, that participate in the excision of introns from nuclear gene transcripts. (d) A sequence (-10) in the nontemplate strand of the promoters of \(E\) coli that facilitates the localized unwinding of DNA when complexed with RNA polymerase. (e) The RNA polymerase in the nucleus that catalyzes the synthesis of all rRNAs except for the small \(5 \mathrm{S}\) rRNA. (f) The subunit of prokaryotic RNA polymerase that is responsible for the initiation of transcription at promoters. (g) \(\operatorname{An} E\). coli promoter sequence located 35 nucleotides upstream from the transcription-initiation site; it serves as a recognition site for the sigma factor. (h) The RNA polymerase in the nucleus that catalyzes the synthesis of the transfer RNA molecules and small nuclear RNAs. (i) A polyadenosine tract 20 to 200 nucleotides long that is added to the \(3^{\prime}\) end of most eukaryotic messenger RNAs. (i) The RNA polymerase that transcribes nuclear genes that encode proteins. (k) \(A\) conserved sequence in the nontemplate strand of eukaryotic promoters that is located about 80 nucleotides upstream from the transcription start site. (1) Segments of a eukaryotic gene that correspond to the sequences in the final processed RNA transcript of the gene. (m) The population of primary transcripts in the nucleus of a eukaryotic cell.

What are the two stages of gene expression? Where do they occur in a eukaryotic cell? a prokaryotic cell?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.