/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Genetics: A Conceptual Approach Chapter 13 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 13

How is transcription different in bacteria and eukaryotes? How is it similar?

Problem 14

An RNA molecule has the following percentages of bases: \(\mathrm{A}=23 \%, \mathrm{U}=42 \%, \mathrm{C}=21 \%,\) and \(G=14 \%\) a. Is this RNA single stranded or double stranded? How can you tell? b. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?

Problem 15

The following diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcribed from this DNA and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA.$$\begin{aligned}&5^{\prime}-\text { ATAGGCGATGCCA }-3^{\prime}\\\&3^{\prime}-\text { TATCCGCTACGGT }-5^{\prime} \leftarrow \text { Template strand }\end{aligned}$$.

Problem 17

The following sequence of nudeotides is found in a single-stranded DNA template: \(ATTGCCAGATCATCCCAATAGAT\). Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA copied from this template.

Problem 18

RNA polymerases carry out transcription at a much Iower rate than that at which DNA polymerases carry out replication. Why is speed more important in replication than in transcription?

Problem 19

Assume that a mutation occurs in the gene that codes for each of the following RNA polymerases. Match the mutation with possible effects by placing the correct Ietter in the blank below. There may be more than one effect for each mutated polymerase. A Mutation in the Gene That Codes for:RNA Polymerase I RNA Polymerase II RNA Polymerase III.Effects._______________,_______________,_____________.Possible Effects a. tRNA not synthesized b. some ribosomal RNA not synthesized c. ribosomal RNA not processed d. pre-mRNA not processed e. some mRNA molecules not degraded f. pre-mRNA not synthesized

Problem 21

Write the consensus sequence for the following set of nudeotide sequences. AGGAGIT AGCTATT TGCAATA ACGAAAA TCCTAAT TGCAATT.

Problem 22

List at least five properties that DNA polymerases and RNA polymerases have in common. List at least three differences.

Problem 23

Most RNA molecules have three phosphate groups at the \(5^{\prime}\) end, but DNA molecules never do. Explain this difference

Problem 26

A strain of bacteria possesses a temperature-sensitive mutation in the gene that cncodes the sigma factor. The mutant bacter ia produce a sigma factor that is unable to bind to RNA polymerase at elevated temperatures What effect will this mutation have on the process of transcription when the bacteria are raised at elevated temperatures?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks