/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 The following sequence of nudeot... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The following sequence of nudeotides is found in a single-stranded DNA template: \(ATTGCCAGATCATCCCAATAGAT\). Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA copied from this template.

Short Answer

Expert verified
a. The DNA has 3' on the left and 5' on the right. b. RNA: 5' UAACGGUCUAGUAGGGUUAUCUA 3'.

Step by step solution

01

Direction of RNA Polymerase

RNA polymerase reads the DNA template in a 3' to 5' direction but synthesizes RNA in a 5' to 3' direction. Since it proceeds from left to right in the given DNA, the left end is the 3' end and the right end is the 5' end.
02

Write the Complementary RNA Sequence

DNA nucleotides pair with RNA nucleotides as follows: A with U, T with A, G with C, and C with G.The given DNA sequence is: \(3' \; ATTGCCAGATCATCCCAATAGAT \; 5'\)The complementary RNA sequence, written from the 5' end to the 3' end, is:\(5' \; UAACGGUCUAGUAGGGUUAUCUA \; 3'\)
03

Identify the RNA Ends

The complementary RNA is synthesized from 5' to 3'. Thus, the nucleotide "U" is at the 5' end, and the nucleotide "A" is at the 3' end of the RNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Polymerase
RNA Polymerase is a crucial enzyme in the process of transcription. Imagine it as a biological machine that reads the genetic information stored in DNA and uses it to synthesize RNA. This enzyme attaches itself to the DNA template and proceeds to "read" the DNA from the 3' end to the 5' end. However, it builds the RNA strand in the opposite direction, from the 5' end to the 3' end. This directional synthesis is important because it ensures that the genetic code is copied correctly.
  • RNA Polymerase binds to a specific sequence called the promoter.
  • It unwinds the DNA strand to expose the template.
  • It catalyzes the addition of ribonucleotides to the growing RNA chain.
This process is vital for gene expression and regulation, as it determines which genes are turned into proteins. RNA Polymerase can be thought of as the starting point of protein synthesis.
Nucleotide Pairing
Nucleotide pairing is fundamental to transcription. It is the process where bases of DNA pair with complementary bases during RNA synthesis. In human cells, DNA bases pair with RNA bases in a very specific manner:
  • Adenine (A) pairs with Uracil (U) in RNA, not Thymine (T) as in DNA.
  • Thymine (T) pairs with Adenine (A).
  • Guanine (G) pairs with Cytosine (C).
  • Cytosine (C) pairs with Guanine (G).
This complementary base pairing ensures the correct sequence of RNA is synthesized from the DNA template. It's the language of nucleotides that dictates how proteins will eventually be assembled. Without proper pairing, the genetic message could become garbled, leading to the production of faulty proteins.
DNA Template
The DNA template is the single strand of DNA that guides the synthesis of RNA. During transcription, only one strand of DNA is used, which is called the template strand. The RNA polymerase reads this strand and creates a complementary RNA sequence.
A DNA template provides the instruction manual for RNA synthesis:
  • It holds the genetic information in sequences called genes.
  • Each gene has regulatory and coding regions.
  • The coding regions determine the sequence of nucleotides in the RNA, which in turn codes for proteins.
The directionality of the template is crucial too, as it affects the synthesis direction of the RNA. The correct orientation ensures the accurate reading of genetic information, crucial for the functioning of cells.
RNA Synthesis
RNA synthesis is the end result of transcription, where a new RNA molecule is formed from a DNA template. This is essentially creating a working copy of the DNA information to be used for protein synthesis in cells. The process of RNA synthesis consists of several key steps that are integral to its function:
- **Initiation:** RNA polymerase binds to the promoter region on the DNA and starts unzipping the DNA strands. - **Elongation:** RNA polymerase moves along the template, adding nucleotides that are complementary to the DNA template. It builds the RNA strand from 5' to 3'. - **Termination:** Once the entire gene is transcribed, the RNA polymerase detaches from the DNA, releasing the newly formed RNA. The resultant RNA can serve multiple roles, such as coding for proteins or functioning as ribosomal RNA (rRNA) or transfer RNA (tRNA), depending on cell needs. Each type of RNA plays a different role in translating and synthesizing proteins. RNA synthesis is therefore not just a copying process, but a critical step in ensuring the cell functions properly.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.