/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 18 RNA polymerases carry out transc... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

RNA polymerases carry out transcription at a much Iower rate than that at which DNA polymerases carry out replication. Why is speed more important in replication than in transcription?

Short Answer

Expert verified
Speed is more crucial in replication to ensure timely cell division and genetic continuity.

Step by step solution

01

Understand the role of RNA polymerases

RNA polymerases are enzymes that synthesize RNA from a DNA template during the process of transcription. They are responsible for the production of various types of RNA, including messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA), which are crucial for protein synthesis.
02

Understand the role of DNA polymerases

DNA polymerases are enzymes that are responsible for copying a cell's DNA before it divides in a process known as DNA replication. This ensures that each new cell receives an exact copy of the original cell's genetic material.
03

Compare the roles of transcription and replication

Transcription, mediated by RNA polymerases, produces RNA molecules needed for protein synthesis and cellular regulation. Replication, mediated by DNA polymerases, is critical for cell division and maintaining genetic continuity.
04

Assess the necessity for speed in replication

Speed in replication is crucial because cells need to divide quickly to promote growth, repair, and efficient reproduction. Thus, DNA polymerases have evolved to synthesize DNA rapidly to keep up with cellular demands.
05

Evaluate speed in transcription

While transcription is essential for protein production and cellular function, the speed of RNA synthesis is not as time-sensitive as DNA replication since it does not directly impact cell division and genetic preservation.
06

Synthesize the reasoning

In summary, while both transcription and replication are vital, replication occurs at a faster rate because it is directly tied to cell division. A delay in DNA replication can halt cell proliferation, while slower transcription rates have less immediate impact on cell survival.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Polymerases
RNA polymerases are fascinating little molecular machines. They have one critical job: to turn DNA into RNA during a process called transcription. Unlike DNA replication, which copies an entire genome, transcription only uses part of the DNA to produce RNA. This RNA is not just one type; it comes in three main forms: messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA). Each of these serves a unique role in the cell.
  • mRNA: Carries the genetic instructions from DNA to the ribosomes, where proteins are made.
  • tRNA: Helps decode the mRNA sequence into a protein.
  • rRNA: Combines with proteins to form ribosomes.
RNA polymerases ensure that all these RNAs are produced accurately so that the cell can keep functioning properly. Transcription is crucial but usually slower because it doesn't have to keep up with cell division like replication does.
DNA Polymerases
DNA polymerases are enzymes that play a vital role in DNA replication. Think of them as the copy machines for genetic material. Before a cell divides, it needs to duplicate its DNA to ensure each new cell has the exact same genetic information. This is a delicate process, as even small errors could cause genetic mutations.
DNA polymerases have several roles:
  • Adding nucleotides: They add new nucleotides to a growing DNA strand, following the template of the original strand.
  • Proofreading: They also check for errors and correct them to ensure fidelity.
  • Initiating replication: They help start the replication process by attaching to the primer.
The efficiency and accuracy of DNA polymerases are extremely important because, without them, errors in DNA could lead to severe consequences for the organism.
Importance of Speed in Replication
The speed at which DNA polymerases work is incredibly significant. In replication, speed is directly connected to how quickly cells can divide. Cells need to divide to allow for growth, repair damaged tissues, and continue species reproduction. This is why DNA replication must happen fast and accurately.
If replication is slow, it can delay cell division. This delay might be dangerous for organism development and function. Therefore, DNA polymerases have evolved to operate swiftly and efficiently. They ensure that the genetic information is copied in record time, keeping pace with the needs of the organism for rapid growth and repair.
Role of Transcription
Transcription is the essential process of copying a segment of DNA into RNA. It may not be as fast as replication, but its importance cannot be understated. The RNA produced through transcription is crucial for the manufacture of proteins. Without transcription, the genetic code contained in DNA would never reach the machinery of the cell to create proteins.
The slower pace of transcription compared to replication doesn't hinder cellular function drastically. Instead, it ensures that the cell makes the right amount of protein at the correct time. It's more about precision than speed. There's a balance between making enough RNA for immediate needs and regulating which genes are expressed at any given time.
Role of Replication
Replication is all about faithfully copying DNA so that cells can divide properly. It's the cornerstone of cellular reproduction, enabling cells to inherit exact genetic blueprints. Without replication, life as we know it wouldn't be feasible, as organisms wouldn't grow, repair, or reproduce effectively.
DNA polymerases oversee this process, ensuring high speed without sacrificing accuracy. Replication needs swift completion to maintain the integrity of genetic information from one cell generation to the next. Because of its crucial role in cell division and genetic integrity, cells prioritize the speed and accuracy of replication over transcription. Replication sets the stage for the very existence of cells, laying down the foundation for all cellular functions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

An RNA molecule has the following percentages of bases: \(\mathrm{A}=23 \%, \mathrm{U}=42 \%, \mathrm{C}=21 \%,\) and \(G=14 \%\) a. Is this RNA single stranded or double stranded? How can you tell? b. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?

Many genes in both bacteria and eukaryotes contain numerous sequences that potentially cause pauses or premature terminations of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or terminating prematurely. However, when a single round of transcription takes place on such templates in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place and frequently shortens the length of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nudeotides along the DNA. Exper imental findings have demonst rated that most transcriptional delays and premature terminations disappear if several RNA polymerases are simultaneoudy transcribing the DNA mdecule. Propose an explanation for faster transcription and longer mRNA when the template DNA is being transcribed by multiple RNA polymerases.

Assume that a mutation occurs in the gene that codes for each of the following RNA polymerases. Match the mutation with possible effects by placing the correct Ietter in the blank below. There may be more than one effect for each mutated polymerase. A Mutation in the Gene That Codes for:RNA Polymerase I RNA Polymerase II RNA Polymerase III.Effects._______________,_______________,_____________.Possible Effects a. tRNA not synthesized b. some ribosomal RNA not synthesized c. ribosomal RNA not processed d. pre-mRNA not processed e. some mRNA molecules not degraded f. pre-mRNA not synthesized

Elaborate repair mechanisms are associated with replication to prevent permanent mutations in DNA, yet no similar repair is associated with transcription. Can you think of a reason for this difference in replication and transcription? (Hint: Think about the relative effects of a permanent mutation in a DNA molecule compared with one in an RNA molecule.)

The following sequence of nudeotides is found in a single-stranded DNA template: \(ATTGCCAGATCATCCCAATAGAT\). Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA copied from this template.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.