/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 19 Assume that a mutation occurs in... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Assume that a mutation occurs in the gene that codes for each of the following RNA polymerases. Match the mutation with possible effects by placing the correct Ietter in the blank below. There may be more than one effect for each mutated polymerase. A Mutation in the Gene That Codes for:RNA Polymerase I RNA Polymerase II RNA Polymerase III.Effects._______________,_______________,_____________.Possible Effects a. tRNA not synthesized b. some ribosomal RNA not synthesized c. ribosomal RNA not processed d. pre-mRNA not processed e. some mRNA molecules not degraded f. pre-mRNA not synthesized

Short Answer

Expert verified
RNA Polymerase I - b; RNA Polymerase II - d, e, f; RNA Polymerase III - a.

Step by step solution

01

Understand the Role of Each RNA Polymerase

RNA polymerase I is primarily responsible for synthesizing most of the rRNA molecules, except for the 5S rRNA. RNA polymerase II synthesizes pre-mRNA, which is processed to form mRNA, as well as some small nuclear RNAs. RNA polymerase III is responsible for synthesizing tRNA and 5S rRNA, among other small RNAs.
02

Match the Mutation Effects for RNA Polymerase I

Since RNA polymerase I synthesizes most ribosomal RNA, a mutation in its gene would result in 'some ribosomal RNA not synthesized' (effect b). It is not involved in mRNA or tRNA synthesis, so other effects do not apply.
03

Match the Mutation Effects for RNA Polymerase II

RNA polymerase II synthesizes pre-mRNA, so a mutation could lead to 'pre-mRNA not synthesized' (effect f). Since it is also involved in processing pre-mRNA into mature mRNA, a mutation may result in 'pre-mRNA not processed' (effect d). As it is also involved in the degradation pathway of mRNA, 'some mRNA molecules not degraded' (effect e) could occur as well.
04

Match the Mutation Effects for RNA Polymerase III

RNA polymerase III is responsible for synthesizing tRNA and 5S rRNA. Therefore, a mutation could cause 'tRNA not synthesized' (effect a). It is also involved in some ribosomal RNA processing, but since this specifically refers to synthesis in the context, effect c would be more secondary.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Gene Mutation
Gene mutations are changes in the sequence of DNA that can affect the way genes function. These mutations can occur due to various reasons, such as environmental factors, errors during DNA replication, or they might even happen spontaneously. A mutation can have several effects, depending on the location and type:
  • Silent mutations do not change the amino acid sequence of proteins.
  • Missense mutations result in a different amino acid.
  • Nonsense mutations introduce a stop codon, potentially truncating proteins.
Changes in the genes encoding RNA polymerases could severely affect RNA synthesis. RNA polymerases are vital enzymes responsible for transcribing DNA into RNA. Mutations in these genes might lead to improper or absent synthesis of various RNA types, which could have widespread effects on cellular functions. Understanding these mutations helps us predict and study the broader implications on cellular mechanisms such as protein synthesis and regulation.
rRNA Synthesis
Ribosomal RNA (rRNA) synthesis is a crucial process in the cell, taking place predominantly within the nucleolus. rRNA molecules are a key component of ribosomes, which are essential for protein synthesis in all living cells. Enzyme RNA Polymerase I is mainly responsible for the synthesis of most rRNA, particularly the large precursors. It's noteworthy that RNA Polymerase III also synthesizes a specific type of rRNA, the 5S rRNA.
A mutation in the gene coding for RNA Polymerase I can lead to the improper synthesis of rRNA, which may cause defects in ribosome assembly. This would negatively impact protein synthesis, as ribosomes may be absent or dysfunctional. Disruptions in rRNA processing, an integral part of maturing the rRNA molecules, could further exacerbate these issues, highlighting the importance of precise regulation during rRNA synthesis.
tRNA Synthesis
Transfer RNA (tRNA) synthesis is facilitated by RNA Polymerase III, which ensures that amino acids are fetched to the ribosome during protein synthesis. Each tRNA molecule is specific to one or a few similar amino acids, and recognizes the corresponding codons on mRNA through its anticodon loop. Thus, tRNA acts as an adaptor molecule during translation.
When a mutation affects RNA Polymerase III, it can disrupt the synthesis of tRNA, leading to an inability to properly translate mRNA into proteins. Without adequate tRNA synthesis, the translation process could stall, affecting the production of proteins crucial for numerous cellular functions. This would have pronounced effects on cellular metabolism and maintenance, emphasizing RNA Polymerase III's vital role in the broader context of gene expression.
mRNA Synthesis
Messenger RNA (mRNA) synthesis is a pivotal stage in gene expression, where genetic information from DNA is transcribed into mRNA by RNA Polymerase II. The mRNA then serves as a template for protein synthesis in the ribosome. This process is tightly controlled and involves various stages of modification and processing, including capping, polyadenylation, and splicing.
If a mutation occurs in the gene coding for RNA Polymerase II, the genesis of pre-mRNA, and its following processing into mature mRNA, can be impaired. This dysregulation might lead to incomplete or faulty proteins being synthesized, potentially disrupting normal cellular processes. Furthermore, the stability and degradation of mRNA are also crucial; mutations might interfere with these pathways, affecting the turnover and availability of mRNAs for translation. By understanding the nuances of mRNA synthesis, scientists can better comprehend how gene mutations might manifest in broader organismal phenotypes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Through genetic engineering, a geneticist mutates the gene that encodes TBP in cultured human cells. This mutation destroys the ability of TBP to bind to the TATA box. Predict the effect of this mutation on cells that possess it.

The following diagram represents DNA that is part of the RNA-coding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcribed from this DNA and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA.$$\begin{aligned}&5^{\prime}-\text { ATAGGCGATGCCA }-3^{\prime}\\\&3^{\prime}-\text { TATCCGCTACGGT }-5^{\prime} \leftarrow \text { Template strand }\end{aligned}$$.

Many genes in both bacteria and eukaryotes contain numerous sequences that potentially cause pauses or premature terminations of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or terminating prematurely. However, when a single round of transcription takes place on such templates in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place and frequently shortens the length of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nudeotides along the DNA. Exper imental findings have demonst rated that most transcriptional delays and premature terminations disappear if several RNA polymerases are simultaneoudy transcribing the DNA mdecule. Propose an explanation for faster transcription and longer mRNA when the template DNA is being transcribed by multiple RNA polymerases.

The following sequence of nudeotides is found in a single-stranded DNA template: \(ATTGCCAGATCATCCCAATAGAT\). Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA copied from this template.

Enhancers are sequences that affect the in itiation of the transcription of genes that are hundreds or thousands of nucleotides away. Transcriptional activator proteins that bind to enhancers usually interact directly with transcription factors at promoters by causing the interven ing DNA to loop out. An enhancer of bacteriophage T4 does not function by looping of the DNA (D. R. Herendeen et al. 1992. Science 256: \(1298-1303\) ). Propose some additional mechanisms (other than DNA looping by which this enhancer might affect transcription at a gene thousands of nucleotides away.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.