Chapter 15: Q. 4 (page 391)
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?
a. complementarity
b. nonsense codons
c. universality
d. degeneracy
Short Answer
Option D is the correct answer.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 15: Q. 4 (page 391)
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?
a. complementarity
b. nonsense codons
c. universality
d. degeneracy
Option D is the correct answer.
All the tools & learning materials you need for study success - in one app.
Get started for free
If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?
A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ polyA tail? a. 220bp b. 295bp c. 140bp d. 435bp.

Which subunit of the E. coli polymerase confers specificity to transcription?
a. α
b. β
c. β'
d. σ
A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)
Which feature of promoters can be found in both prokaryotes and eukaryotes? a. GC box b. TATA box c. octamer box d. -10 and -35 sequences
What do you think about this solution?
We value your feedback to improve our textbook solutions.