/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q. 24 A fragment of bacterial DNA read... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Short Answer

Expert verified

ACUAUCUUCGUGAGAUG

Step by step solution

01

Step 1. Introduction

Transcription is the process of copying of information from DNA strands into messenger RNA. It is simply a synthesis of RNA from a DNA template.

02

Step 2. Explanation

ACUAUCUUCGUGAGAUG

By analyzing the DNA sequence, it can be noted that there is a -10 consensus sequence near the 3’ end of the fragment. If we then estimate downstream, the +1 initiation site is the T instantly following the sequence AAT. This signifies the DNA fragment that will act as the template for transcription has the sequence TGATAGAAGCACTCTAC.

These bases form specific cytosine pairs with guanine and thymine with adenine. In RNA Uracil is present instead of Thymine.

ACUAUCUUCGUGAGAUG is a transcribed mRNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.