/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q. 10 Which feature of promoters can b... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 15: Q. 10 (page 391)

Which feature of promoters can be found in both prokaryotes and eukaryotes? a. GC box b. TATA box c. octamer box d. -10 and -35 sequences

Short Answer

Expert verified

Option b is correct.

Step by step solution

01

Step 1. Introduction

Promoters are present in DNA which is the region from where RNA polymerase starts to transcribe genes. It basically initiates transcription.

02

Step 2. Explanation of the correct option

Option b is correct because the TATA box is found both in prokaryotes as well as Eukaryotes.

TATA box sequence resembles the -10 sequence in prokaryotes and in eukaryotes its located at about +25.

03

Step 3. Explanation of the incorrect option

Option a is incorrect because the GC box is located in the promoter region of eukaryotes upstream of the TATA box.

Option c is incorrect because octamer binding proteins are highly conserved transcription factors not found in both prokaryotes and eukaryotes.

option d is incorrect because -10 and -35 sequences are found in prokaryotes only.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Chloramphenicol would directly affect

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation?

a. Translation stalls after the initiation AUG codon is identified.

b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites.

c. The ribosome cannot interact with mRNAs.

d. tRNAs cannot exit the E site of the ribosome.

A fragment of bacterial DNA reads: 3鈥� 鈥揟ACCTATAATCTCAATTGATAGAAGCACTCTAC鈥� 5鈥� Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Discuss how degeneracy of the genetic code makes cells more robust to mutations.
See all solutions

Recommended explanations on Biology Textbooks

Chemistry of Life

Read Explanation

Cellular Energetics

Read Explanation

Astrobiological Science

Read Explanation

Biological Molecules

Read Explanation

Energy Transfers

Read Explanation

Substance Exchange

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.