/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} 18.question A scientist introduces a mutatio... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation?

a. Translation stalls after the initiation AUG codon is identified.

b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites.

c. The ribosome cannot interact with mRNAs.

d. tRNAs cannot exit the E site of the ribosome.

Short Answer

Expert verified

The mutation process can only change the sequence of nucleotides, and once the start codon is located, the translation process begins.

Step by step solution

01

step-1: Introduction

The ribosome is a complex molecule made up of ribosomal RNA molecules and proteins that functions as a factory in cells to produce proteins.

02

step-2: Explanation of correct answer

Option (a) causes translation to halt once the start codon AUG is found. When pre mRNA is cleaved, 60 s ribosomal subunit and 40 s ribosomal subunit are formed. Nucleotide sequences are modified throughout the mutation process. Translation will begin after the start codon AUG is identified on the sequence.

03

Step-3: Explanation of incorrect answers 

Option (b) Ribosomes are unable to catalyze the formation of peptide bonds between the A and P sites of the tRNAs. Peptide bonds are formed by peptidyltransferase, an RNA-based enzyme found in the 50 s subunit of the ribosome but not in the 60 s subunit.

Option (c) Ribosomes are incapable of interacting with mRNAs.

After the start codon is discovered, tRNAs form a translation complex with the help of amino-acyl tRNA synthetase, which recruits small and large subunits dissociated from mRNA as Met-tRNA.

Option (d)tRNAs are unable to leave the ribosome's E site.

After the peptide bond is created, tRNA goes from the A site to the P site before being removed from the E site of the ribosome.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? a. Translation stalls after the initiation AUG codon is identified. b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites. c. The ribosome cannot interact with mRNAs. d. tRNAs cannot exit the E site of the ribosome

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?

Which event contradicts the central dogma of molecular biology?

a. Poly-A polymerase enzymes process mRNA in the nucleus.

b. Endonuclease enzymes splice out and repair damaged DNA.

c. Scientists use reverse transcriptase enzymes to make DNA from RNA.

d. Codons specifying amino acids are degenerate and universal.

How do enhancers and promoters differ? a. Enhancers bind transcription factors to silence gene expression, while promoters activate transcription. b. Enhancers increase the efficiency of gene expression but are not essential for transcription. Promoter recognition is essential to transcription initiation. c. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription. d. There is no difference. Both are transcription factor-binding sequences in DNA.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.