/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} 19.question Imagine if there were 200 common... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.

Short Answer

Expert verified

Each codon is made up of three nucleotides that each represent a different amino acid. There will be four nucleotide-containing codons with less degeneracy in the genetic code for every 200 amino acids.

Step by step solution

01

step-1: Definition

The genetic codes are the complete collection of relationships between codons and amino acids. With the exception of three codons, the genetic code is made up of 64 triplets of nucleotides, each of which encodes for one of the 20 amino acids used in protein production.

02

step-2: Introduction

The nucleotides in mRNAs are read in groups of three, termed codons, by the cell to decode them. During the production of polypeptides, mRNA codons are read from5'→3'direction.

Each amino acid's genetic code is defined by a unique nitrogenous base, which is made up of the letters A, U, G, and C. In polypeptide synthesis, codons play a key role in starting and stopping the process.

03

step-3: Explanation

DNA has nitrogenous bases such as Adenine, Cytosine, Guanine, and Thymine, but RNA contains nitrogenous bases with the exception of Thymine, which is substituted by Uracil, and the remaining three are the same as DNA.

There are 64 codons, each of which consists of three nucleotides, for a total of 20 amino acids. Because of the degeneracy of genetic coding, this is estimated as 64. Degeneracy refers to the fact that a single amino acid can be specified by many codon sets. We can find out codon set as follows for a specification of 20 amino acids from four nucleotides:

43=4×4×4=64

Because amino acids are generated through the DNA-RNA transcription and translation process, there will be the same amount of nucleotides for 200 regularly occurring amino acids as there will be for 20 amino acids. When computing codons for 200 amino acids, at least four nucleotides should be present.

44=4×4×4×4=256

The feature of degeneracy of genetic code cannot be recognized in this situation due to the presence of a codon with a length of four nucleotides.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

How do enhancers and promoters differ? a. Enhancers bind transcription factors to silence gene expression, while promoters activate transcription. b. Enhancers increase the efficiency of gene expression but are not essential for transcription. Promoter recognition is essential to transcription initiation. c. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription. d. There is no difference. Both are transcription factor-binding sequences in DNA.

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Chloramphenicol would directly affect

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect ?

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? a. Translation stalls after the initiation AUG codon is identified. b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites. c. The ribosome cannot interact with mRNAs. d. tRNAs cannot exit the E site of the ribosome

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.