/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} 5.question How many nucleotides are in 12 m... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 15: 5.question (page 391)

How many nucleotides are in 12 mRNA codons?

a. 12

b. 24

c. 36

d. 48

Short Answer

Expert verified

In each of the 12 codons of mRNA, there are 36 nucleotide bases.

Step by step solution

01

step-1: Introduction

A single-stranded RNA molecule called messenger RNA (mRNA) is complementary to one of a gene's DNA strands.

02

step-2: Explanation of correct answer

Option (c) 36 numbers. This is caused by genetic code degeneration. The degeneracy of genetic coding states that there are 64 codes of three nucleotides for every 20 amino acids. When a codon is a singlet (41=4), there are only four possible combinations of A,U,G, and C. It can make 16 distinct combinations (42)as a doublet, but it can produce 64 different combinations as a triplet (43), which is enough to encode for 20 amino acids. Because triplets comprise three nucleotides.

12脳3=36

there are a total of 36 nucleotides in 12 codons for 12 mRNA.

03

step-3: Explanation of incorrect answer

Option (a) 12 number. This number is not possible because the number of nucleotide asked is for 12mRNA only . We can get this number of nucleotides when 4mRNA is asked .
Option (b) 24.This number is not possible because number of nucleotide asked is for only12mRNA . We can get this number of nucleotides when8mRNA is asked.
Option (d) 48 numbers. This number is not possible because number of nucleotide asked is for only 12mRNA. We can get this number of nucleotides when 16mRNAis asked.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In your own words, describe the difference between rho dependent and rho-independent termination of transcription in prokaryotes.

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.

A fragment of bacterial DNA reads: 3鈥� 鈥揟ACCTATAATCTCAATTGATAGAAGCACTCTAC鈥� 5鈥� Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Which feature of promoters can be found in both prokaryotes and eukaryotes?

a. GC box

b. TATA box

c. octamer box

d. -10 and -35 sequences

Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
See all solutions

Recommended explanations on Biology Textbooks

Biological Structures

Read Explanation

Chemistry of Life

Read Explanation

Cell Communication

Read Explanation

Control of Gene Expression

Read Explanation

Biological Processes

Read Explanation

Cell Cycle

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.