/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q. 21 A scientist sequencing mRNA iden... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 15: Q. 21 (page 392)

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated

Short Answer

Expert verified

Met Cys Arg Asn Ser Arg

Step by step solution

01

Step 1. Introduction

The process through which information encoded in mRNA is translated into amino acid during protein synthesis is known as translation.

02

Step 2. Explanation

Amino acids writing first begins with the start codon AUG. Then the nucleotide sequences are separated in triplets. Then these triplets are translated into amino acids and translation stops at stop codon UGA.

Codon mention in question will for sequence Met Cys Arg Asn Ser Arg.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What transcripts will be most affected by low levels of 伪amanitin?

a. 18S and 28S rRNAs

b. pre-mRNAs

c. 5S rRNAs and tRNAs

d. other small nuclear RNAs

15. A scientist identifies a pre-mRNA with the following structure.

What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5鈥� cap and 3鈥� polyA tail?

a. 220bp

b. 295bp

c. 140bp

d. 435bp

A fragment of bacterial DNA reads: 3鈥� 鈥揟ACCTATAATCTCAATTGATAGAAGCACTCTAC鈥� 5鈥� Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

How do enhancers and promoters differ? a. Enhancers bind transcription factors to silence gene expression, while promoters activate transcription. b. Enhancers increase the efficiency of gene expression but are not essential for transcription. Promoter recognition is essential to transcription initiation. c. Promoters bind transcription factors to increase the efficiency of transcription. Enhancers bind RNA polymerases to initiate transcription. d. There is no difference. Both are transcription factor-binding sequences in DNA.

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy
See all solutions

Recommended explanations on Biology Textbooks

Ecological Levels

Read Explanation

Responding to Change

Read Explanation

Heredity

Read Explanation

Astrobiological Science

Read Explanation

Organ Systems

Read Explanation

Genetic Information

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.